Carissa carandas

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Carissa

At a glance

Occurrence records576

Data sources10

Biological traits24

DNA specimens17

eDNA detections10

Sources10 archives

Databases and archives Carissa carandas's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility576 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF576 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Carissa carandas est une espèce de plante à fleur dans la famille des Apocynaceae. Il produit des fruits de la taille des baies couramment utilisés comme condiments ou additifs dans les plats saumurés indiens et épices. C'est une plante très résistante, qui tolère la sécheresse et qui pousse bien dans une grande diversité de sols. Ses appellations courantes incluent Karonda, Karau(n)da, Karanda parfois écrit Karamda.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length20 mm

Fruit length max25 mm

Fruit length min15 mm

Leaf length35 mm

Leaf length max40 mm

Leaf length min30 mm

Leaf width max35 mm

Leaf width min20 mm

Plant height4 m

Life cycle & reproduction6

Deciduousnessevergreen

Flowering endFeb

Flowering startSep

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 500 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition10 compounds

Compounds documented for Carissa carandas across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Eudesmane sesquiterpenoids2

Dibenzylbutane lignans2

Arylnaphthalene and aryltetralin lignans2

Furanoid lignans1

Dibenzylbutyrolactone lignans1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Nortrachelogenin	present	LOTUS
(+)-Ursolic Acid	present	LOTUS
(-)-Carinol	present	LOTUS
(2R,3R)-2,3-bis[(4-hydroxy-3-methoxyphenyl)methyl]butane-1,2,4-triol	present	LOTUS
(2R,3R,4R)-3,4-bis[(4-hydroxy-3-methoxyphenyl)methyl]oxolane-2,3-diol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(1R,2S,3S)-7-hydroxy-1-(4-hydroxy-3,5-dimethoxyphenyl)-3,6,8-trimethoxy-1,2,3,4-tetrahydronaphthalen-2-yl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(1S,2R,3R)-7-hydroxy-1-(4-hydroxy-3,5-dimethoxyphenyl)-3,6,8-trimethoxy-1,2,3,4-tetrahydronaphthalen-2-yl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(4aS,7S)-7-(2-hydroxypropan-2-yl)-1,4a-dimethyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,6,7,8-tetrahydronaphthalen-2-one	present	LOTUS
Oleanolic acid	present	LOTUS
Spiro(naphthalene-2(3H),2'(3'H)-naphtho(1,2-b)furan)-3,3',4'(3'aH)-trione, 1,5,6,6',7,7',8,8',8a,9',9'a,9'b-dodecahydro-6,7'-bis(1-hydroxy-1-methylethyl)-4,5',8a,9'a-tetramethyl-	present	LOTUS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carissa carandas has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes6

GenBank sequences5

eDNA detections10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHQ386688.1 ↗682 bp

ACGT

GCTCATTGTCGATCCTGCAACAAACGACCCGTGAACTCGTTCAACCGCGGGCGCCGGGCGCGGGGGTCCTCCCTGCGCCCGGTGCCCCCT …

Carissa carandas 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS2rpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Carissa carandas carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 227×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov +1

CCDB · ipcn-api-dl — Sarkar, A. K. & N. DATTA. 1986. Karyomorphological studies of Carissa L. (Apocynaceae) to ascertain their taxonomic affinities. Cell Chromosome Res. 9: 4–6.

CCDB · ipcn-api-dl — CHAUHAN, A. K. S. & S. S. Raghuvanshi. 1977. Cytogenetical studies of some members of Apocynaceae. Cytologia 42: 723–729.

CCDB · book-indian_vol1 — Singh, B. 1951; Tapadar, N. N. Roy & Sen N.K. 1960a, b ; Tapadar, N.N. Roy 1964a ; Chauhan, cA.K.S. & Raghuvanshi, S.S. 1977; Balamani,. G. V.A. 1980

CCDB · book-fedorov — Singh B. 1951

CCDB · book-fedorov — Tapadar, Sen 1960

CCDB · book-fedorov — Tapadar 1964a

CCDB · book-atlas-flowering-plants — Singh 1951

n 114×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sarkar, A. K. & N. DATTA. 1986. Karyomorphological studies of Carissa L. (Apocynaceae) to ascertain their taxonomic affinities. Cell Chromosome Res. 9: 4–6.

CCDB · ipcn-api-dl — Sanjappa, M. & A. Dasgupta. 1981. In Chromosome number reports LXXI. Taxon 30: 508–509.

CCDB · ipcn-api-dl — Balamani, G. V. A. & R. S. Rao. 1981. In Chromosome number reports LXXIII. Taxon 30: 855–856.

CCDB · ipcn-api-dl — CHAUHAN, A. K. S. & S. S. Raghuvanshi. 1977. Cytogenetical studies of some members of Apocynaceae. Cytologia 42: 723–729.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type576 records

Wild obs. + sensor488

Museum / vouchered88

Range

Area of Occupancy AOO1 792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 237≤1 km 24≤10 km 20>10 km 10

291 georeferenced · 197 without coordinates

Open the mapobservation + sensor488

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 2≤1 km 31≤10 km 8>10 km 4

45 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	34
Pondicherry, IN	9
Taipei, TW	5
Natural History Museum, Tribhuvan Universitylocation not on record	5
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	3
HAWlocation not on record	2
St. Augustine, TT	2
Santa Barbara, US	2
IFAN Ch. A. Dioplocation not on record	1
Guangzhou, CN	1
Northridge, US	1
Bronx, US	1
Bharathiar Universitylocation not on record	1
Moscow State Universitylocation not on record	1
Long Beach, US	1
Miami, US	1
St. Paul, US	1
Nanjing, CN	1
Gujarat Biodiversity Gene Banklocation not on record	1
Bando, JP	1
Dehra Dun, IN	1

21 institutions · 75 of 88 vouchered records shown · 13 without an institution code

09Environmental DNA10 detections

Where the DNA of Carissa carandas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 13.2–23.2

Seasonal swing summer↔winter21.2 °C

Max temp (day)20.2 °C 20.2–27.2

Min temp (night)7.50 °C 7.50–18.2

Precipitation13.7 mm/mo 13.7–49.5

Air humidity55.3 % 55.3–60.4

Moisture balance-40.5 mm/mo -87.7–-40.5

Vapour deficit675 Pa 675–1,117

Wind speed2.10 m/s 2.10–2.80

Cloud cover33.1 % 18.2–33.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)