Carissa bispinosa

(L.) Desf. ex Brenan · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Carissa

At a glance

Occurrence records2 638

Data sources8

Biological traits31

DNA specimens15

eDNA detections11

Sources8 archives

Databases and archives Carissa bispinosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources31 traits

Occurrence & distributionGBIF2 638 records

Environmental DNA1 datasets · 3 countries11 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB2n = 22

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height3 m

⚠ sources differ — GIFT: 3 m · TRY: 5 m

Plant height max5.5 m

Plant height min0.2 m

Seed mass49.43 mg

Seed mass max50.45 mg

Seed mass min48.4 mg

Life cycle & reproduction6

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Life formscrambling shrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 050 m

Elevation min0 m

Epiphyteterrestrial

Fruit typeberry

Growth formshrub

Habitat GIFTdry bush- or woodland

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio31.83 g/g

Leaf c440 mg/g

Leaf dry-matter content (LDMC)497 mg/g

Leaf n15.05 mg/g

Leaf p0.6 mg/g

Nitrogen fixingnon_nitrogen_fixer

Specific leaf area (SLA)10.25 mm²/mg

Wood density646 mg/cm³

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carissa bispinosa has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes5

GenBank sequences6

eDNA detections11

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLJF265326.1 ↗552 bpSouth Africa · 2005

ACGT

AGTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACTAAAGATACTGATATCTTGGCAGCA …

Carissa bispinosa subsp. bispinosa voucher OM253 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★trnLtrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Carissa bispinosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — CHAUHAN, A. K. S. & S. S. Raghuvanshi. 1977. Cytogenetical studies of some members of Apocynaceae. Cytologia 42: 723–729.

CCDB · ipcn-api-dl — Sarkar, A. K. & N. DATTA. 1986. Karyomorphological studies of Carissa L. (Apocynaceae) to ascertain their taxonomic affinities. Cell Chromosome Res. 9: 4–6.

CCDB · ipcn-api-dl — Laan, F. M. v. d. & J. C. Arends. 1985. Cytotaxonomy of Apocynaceae. Genetica 68: 3–35.

n 112×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — CHAUHAN, A. K. S. & S. S. Raghuvanshi. 1977. Cytogenetical studies of some members of Apocynaceae. Cytologia 42: 723–729.

CCDB · ipcn-api-dl — Sarkar, A. K. & N. DATTA. 1986. Karyomorphological studies of Carissa L. (Apocynaceae) to ascertain their taxonomic affinities. Cell Chromosome Res. 9: 4–6.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 638 records

Wild obs. + sensor2 003

Museum / vouchered634

Cultivated / captive1

Range

Area of Occupancy AOO5 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 325≤1 km 200≤10 km 55>10 km 30

1 610 georeferenced · 393 without coordinates

Open the mapobservation + sensor2 003

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤1 km 14≤10 km 8>10 km 3

25 georeferenced · 609 without coordinates

Open the institutions mapphysical evidence634

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	371
Durban, ZA	102
Kew, GB	19
Instituto de Investigação Científica Tropicallocation not on record	16
MeiseBGlocation not on record	9
Saint Louis, US	6
Zürich, CH	4
MSB-3054location not on record	3
Bronx, US	2
University of Johannesburglocation not on record	2
Cape Town, ZA	2
South African National Biodiversity Institutelocation not on record	2
Uppsala, SE	2
Auckland, NZ	2
National Herbarium & Botanic Gardens of Malawilocation not on record	1
Claremont, US	1
Baroda, IN	1
TAFORI-LSRClocation not on record	1
Dekalb, US	1
Miami, US	1
St. Paul, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Vancouver, CA	1
Gujarat Biodiversity Gene Banklocation not on record	1
Universität Göttingenlocation not on record	1
UFRPElocation not on record	1

26 institutions · 554 of 634 vouchered records shown · 80 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Carissa bispinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 9.80–23.5

Seasonal swing summer↔winter8.70 °C

Max temp (day)23.0 °C 14.2–29.7

Min temp (night)14.4 °C 4.70–17.4

Precipitation75.3 mm/mo 10.6–96.9

Air humidity58.6 % 49.7–61.8

Moisture balance-50.9 mm/mo -113–-7.00

Vapour deficit775 Pa 554–1,409

Wind speed2.90 m/s 2.60–3.60

Cloud cover22.2 % 15.8–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carissa bispinosa

At a glance

Sources8 archives

Size & morphology6

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry8

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 638 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 26 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 638 records