Carinaria lamarckii

Blainville, 1817 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Carinariidae/Carinaria

At a glance

Occurrence records420

Data sources7

Biological traits5

DNA specimens5

eDNA detections0

Sources7 archives

Databases and archives Carinaria lamarckii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility213 records↗

OBISOcean Biodiversity Information System207 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS420 records

DNA & barcodingBOLD5 specimens

01Narrative

Carinaria lamarckii is a species of sea gastropod, a holoplanktonic marine gastropod mollusk in the family Carinariidae.Rosenberg, G. (2011). Carinaria lamarckii Blainville, 1817. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=416623 on 2011-02-07

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length11.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max675 m

Depth min0 m

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carinaria lamarckii has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Diversity (π)4.1%

Haplotypes2

BINs2

Most divergent pair10.0%

Where individuals differ — all 66 variable positions, in barcode order

41Gmostly conserved

58Tmostly conserved

61Tmostly conserved

64Cmostly conserved

73Amostly conserved

79Gmostly conserved

92Tmostly conserved

112Tmostly conserved

160Gvariable

181Gmostly conserved

187Tmostly conserved

202Cmostly conserved

212Cmostly conserved

253Amostly conserved

259Tmostly conserved

271Tmostly conserved

283Amostly conserved

286Tmostly conserved

287Cmostly conserved

289Gmostly conserved

310Gmostly conserved

313Cmostly conserved

319Amostly conserved

328Tmostly conserved

337Tmostly conserved

340Cmostly conserved

343Tvariable

349Tmostly conserved

352Cmostly conserved

355Amostly conserved

361Amostly conserved

367Tmostly conserved

376Gmostly conserved

386Tmostly conserved

400Tmostly conserved

403Amostly conserved

406Cmostly conserved

418Amostly conserved

428Cmostly conserved

436Cmostly conserved

439Amostly conserved

451Cmostly conserved

460Tmostly conserved

463Cmostly conserved

466Gmostly conserved

500Cmostly conserved

502Tmostly conserved

514Cmostly conserved

529Gmostly conserved

535Tmostly conserved

539Cmostly conserved

542Tmostly conserved

547Cmostly conserved

550Tmostly conserved

553Gmostly conserved

556Gmostly conserved

557Cmostly conserved

559Amostly conserved

586Cmostly conserved

595Cmostly conserved

601Cmostly conserved

619Amostly conserved

622Tmostly conserved

625Tmostly conserved

643Gmostly conserved

652Cmostly conserved

AACTTTATATATTTTATTTGGTATATGATCAGGTTTAGTTGGTACTGCACTAAGCCTTCTTATCCGTGCAGAACTTGGGCAACCAGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Firoloida desmarestiasame order16.5%Atlanta peroniisame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type420 records

Wild obs. + sensor204

Museum / vouchered155

Other61

Range

Area of Occupancy AOO516 km²

Depth

0–200 m sunlit112

200–1000 m twilight41

1–4 km midnight36

>4 km abyssal3

median 2.1 m · max 4 766 m · 192 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy2% within 1 km

≤100 m 2≤1 km 1≤10 km 158>10 km 9

170 georeferenced · 34 without coordinates

Open the mapobservation + sensor204

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 3≤10 km 3>10 km 57

63 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	52
Frankfurt am Main	27
Philadelphia, US	6
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	3
NTNU-VMlocation not on record	1
Paris, FR	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
WoRMS Editorial Boardlocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Brussels, BE	1
Copenhagen, DK	1
RBINS-Scientific Heritagelocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1
Sydney, AU	1

14 institutions · 98 of 155 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)