Carex zotovii

(Hamlin) K.A.Ford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records648

Data sources5

Biological traits23

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Carex zotovii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility648 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF648 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 88

01Narrative

Uncinia zotovii là loài thực vật có hoa trong họ Cói. Loài này được Hamlin miêu tả khoa học đầu tiên năm 1959.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length max30 mm

Leaf width3 mm

Leaf width max3 mm

Leaf width min3 mm

Plant height0.45 m

Plant height max0.6 m

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeunspecialized

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex zotovii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN762203.1 ↗620 bpNew Zealand

ACGT

TTGTCGTTTGCCTCTCGAAAAACACGGACCGTTGCACGCGTGACAGAATGCCGCCGGGGAGGCGCCCGCCGCCTCCCCGGCCCCGCCGGC …

Carex zotovii isolate spm00004411 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex zotovii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 88 n = 44

Chromosome records88–882n range88median88mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 882×CCDB · new-zealand · CCDB · book-ipcn67-71

CCDB · new-zealand

CCDB · book-ipcn67-71 — BEUZENBERG, E.J. 1970. Contributions to a chromosome atlas of the New Zealand flora. 14. Uncinia (Cyperaceae). New Zealand J. Bot. 8: 260-263.

08Occurrence & distribution

Record type648 records

Wild obs. + sensor278

Museum / vouchered370

Range

Area of Occupancy AOO1 740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 256≤1 km 10≤10 km 5>10 km 3

274 georeferenced · 4 without coordinates

Open the mapobservation + sensor278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 4

7 georeferenced · 363 without coordinates

Open the institutions mapphysical evidence370

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	267
Wellington, NZ	71
Rotorua, NZ	24
Auckland, NZ	7
Palmerston North, NZ	1

5 institutions · 370 of 370 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)