Carex wiegandii

Mack. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records269

Data sources8

Biological traits10

DNA specimens6

eDNA detections5

Sources8 archives

Databases and archives Carex wiegandii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility269 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF269 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Carex wiegandii est une espèce de plantes du genre Carex et de la famille des Cyperaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex wiegandii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences6

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG216548.1 ↗348 bpUSA · 1999

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …

Carex wiegandii voucher B0748 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type269 records

Wild obs. + sensor88

Museum / vouchered181

Range

Area of Occupancy AOO704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 45≤1 km 5≤10 km 1>10 km 18

69 georeferenced · 19 without coordinates

Open the mapobservation + sensor88

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤1 km 20≤10 km 16>10 km 6

42 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université Lavallocation not on record	29
Montréal, CA	25
Saint John, CA	24
Ann Arbor, US	24
Québec, CA	17
Madison, US	9
Acadia Universitylocation not on record	9
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
University of New Hampshirelocation not on record	5
Chongqing Museumlocation not on record	3
Burlington, US	3
Chicago, US	3
Bronx, US	3
University of Stellenboschlocation not on record	2
St. Paul, US	2
Tampa, US	2
San Angelo, US	2
Toronto, CA	1
Dover, US	1
Delaware State University, Claude E. Phillips Herbariumlocation not on record	1
University of Alberta Museumslocation not on record	1
Museum of the Rockieslocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Vancouver, CA	1
Whitehorse, CA	1
University of Toronto Mississaugalocation not on record	1
Wellington, NZ	1

27 institutions · 179 of 181 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Carex wiegandii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 19.0–19.0

Seasonal swing summer↔winter25.4 °C

Max temp (day)23.2 °C

Min temp (night)15.7 °C

Precipitation101 mm/mo

Air humidity62.5 %

Moisture balance-49.5 mm/mo

Vapour deficit818 Pa

Wind speed3.60 m/s

Cloud cover48.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)