Carex wakatipu

Petrie · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records478

Data sources7

Biological traits20

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Carex wakatipu's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility478 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF478 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Carex wakatipu est une espèce des plantes du genre Carex et de la famille des Cyperaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf width3 mm

Leaf width max3 mm

Leaf width min3 mm

Seed length1.5 mm

Seed length max1.5 mm

Seed length min1.5 mm

Seed mass1 mg

Seed mass max1 mg

Seed mass min1 mg

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTAlpine

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex wakatipu has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU352238.1 ↗771 bpNew Zealand

ACGT

GGCGGTTCGCCGCCTGTGACGTCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Carex wakatipu isolate 00606E 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type478 records

Wild obs. + sensor99

Museum / vouchered379

Range

Area of Occupancy AOO1 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 75≤1 km 13≤10 km 2>10 km 1

91 georeferenced · 8 without coordinates

Open the mapobservation + sensor99

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 1≤10 km 2>10 km 2

6 georeferenced · 373 without coordinates

Open the institutions mapphysical evidence379

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	270
Wellington, NZ	65
Auckland, NZ	39
Hobart, AU	1
Brisbane, AU	1
Museo Entomologico de Leonlocation not on record	1
Chicago, US	1
GZUlocation not on record	1

8 institutions · 379 of 379 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Carex wakatipu was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)