Carex vulpinoidea
Michx. · speciesAt a glance
Occurrence records10 947
Data sources11
Biological traits122
DNA specimens24
eDNA detections27
Sources11 archives
Databases and archives Carex vulpinoidea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 947 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics24 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources122 traits
Occurrence & distributionGBIF10 947 records
Environmental DNA1 datasets · 2 countries27 detections
DNA & barcodingBOLD · NCBI24 specimens
Genome at a glanceCCDB · GoaT444 Mbp
01Narrative
Carex vulpinoidea ou Fausse Laîche des renards est une espèce des plantes du genre Carex et de la famille des Cyperaceae. On considère que cette plante fait partie de la flore obsidionale de France.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVPUSDA
Size & morphology16
Leaf width5 mm
Leaf width max5 mm
Leaf width min5 mm
Plant height0.75 m
⚠ sources differ — GIFT: 0.75 m · USDA: 0.975 m · TRY: 0.3 m
Plant height generative0.33 m
Plant height max1 m
Plant height min0.3 m
Seed length1 mm
Seed length max1 mm
Seed length min1 mm
Seed mass0.946 mg
⚠ sources differ — TRY: 0.946 mg · LEDA: 0.241 mg · GIFT: 0.503 mg
Seed mass max2.1 mg
Seed mass min0.32 mg
Seed width1 mm
Seed width max1 mm
Seed width min1 mm
Life cycle & reproduction33
After harvest regrowth rateSlow
Bloom periodSpring
Coppice potentialNo
Deciduousnessn.d.
⚠ sources differ — TRY: n.d. · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeunspecialized
Flower colourgreen
Flower conspicuousNo
Flowering endJun
Flowering startApr
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Resprout abilityNo
Seed spread rateModerate
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment27
Active growth periodSpring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colouryellow
Fruit typeachene
Growth formherb
Growth form USDABunch
Habitat GIFTLowland
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.0000618
Root depth min16 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry23
Anaerobic toleranceMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantYes
Fire toleranceLow
Frost free days min110 days
Leaf C:N ratio15.64 g/g
Leaf c430 mg/g
Leaf dry-matter content (LDMC)315 mg/g
Leaf n27.53 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max65 in
Precipitation min12 in
Salinity toleranceNone
Shade toleranceMedium
Soil pH max8.9 pH
Soil pH min6.8 pH
Specific leaf area (SLA)18.23 mm²/mg
Temperature min-38 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 297 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typefruit with appendage
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max19 000 per acre
Planting density min10 912 per acre
05DNA & barcoding24 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex vulpinoidea has left across the world's sequence archives.
At a glance
DNA specimens24
Marker genes7
GenBank sequences10
eDNA detections27
Countries2
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Carex vulpinoidea voucher B0743 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS2atpF-atpHtrnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Carex vulpinoidea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size444 012 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex vulpinoidea0.44 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 52 n = 26
Chromosome records52–522n range52median52mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 523×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · carex
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
CCDB · carex — Moore, R. J. & J. A. Calder 1964; Love, A. & D. Love 1981, cited in Hipp 2007
08Occurrence & distribution
Record type10 947 records
Wild obs. + sensor3 854
Museum / vouchered7 083
Cultivated / captive4
Other6
Origin
Native15
Introduced18
Range
Area of Occupancy AOO30 880 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy74% within 1 km
≤100 m 1 969≤1 km 297≤10 km 509>10 km 271
3 046 georeferenced · 808 without coordinates
Open the mapobservation + sensor3 854
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 462≤1 km 1 238≤10 km 1 777>10 km 250
3 727 georeferenced · 3 356 without coordinates
Open the institutions mapphysical evidence7 083
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 4 records without
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions134 of 216 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 589 |
| Philadelphia, US | 435 |
| Wuzhou, CN | 435 |
| Chongqing Museumlocation not on record | 411 |
| Madison, US | 402 |
| Jackson, US | 395 |
| St. Paul, US | 338 |
| Oregon State Universitylocation not on record | 288 |
| Chicago, US | 251 |
| International Salmonella Centre (W.H.O.)location not on record | 208 |
| Montréal, CA | 184 |
| Ann Arbor, US | 183 |
| Bloomington, US | 157 |
| Saint Louis, US | 114 |
| Québec, CA | 105 |
| Toronto, CA | 96 |
| College Park, US | 87 |
| Christchurch, NZ | 75 |
| University of Stellenboschlocation not on record | 71 |
| Burlington, US | 67 |
| Green Bay, US | 63 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 60 |
| Williamsburg, US | 58 |
| Bangkok, TH | 55 |
| Allentown, US | 49 |
| Acadia Universitylocation not on record | 48 |
| University of New Hampshirelocation not on record | 45 |
| McWane Science Centerlocation not on record | 43 |
| Dover, US | 43 |
| WTUlocation not on record | 41 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 40 |
| Tampa, US | 39 |
| University of Wisconsinlocation not on record | 38 |
| Flagstaff, US | 37 |
| Pullman, US | 37 |
| Vancouver, CA | 36 |
| Auckland, NZ | 35 |
| Dekalb, US | 32 |
| Université Lavallocation not on record | 31 |
| Whitewater, US | 26 |
| University of Toronto Mississaugalocation not on record | 25 |
| Fayetteville, US | 25 |
| Moscow, US | 24 |
| Austin, US | 24 |
| Lincoln, US | 24 |
| Tuscaloosa, US | 23 |
| Fort Worth, US | 22 |
| Chadron, US | 22 |
| Montréal, CA | 22 |
| ASUlocation not on record | 20 |
| Philadelphia, US | 19 |
| Corvallis, US | 19 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 19 |
| Lord Fairfax Community Collegelocation not on record | 18 |
| Denver, US | 18 |
| San Angelo, US | 18 |
| Knoxville, US | 18 |
| Museum of the Rockieslocation not on record | 17 |
| Chapel Hill, US | 17 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 17 |
| Salzburg, AT | 16 |
| Saint John, CA | 16 |
| Chicago, US | 15 |
| Johnson City, US | 15 |
| Mississippi State, US | 15 |
| Albuquerque, US | 15 |
| New Haven, US | 15 |
| Morgantown, US | 14 |
| BAYLUlocation not on record | 14 |
| South Kensington, GB | 14 |
| University of Alberta Museumslocation not on record | 13 |
| Emporia, US | 13 |
| University of Tennessee at Chattanoogalocation not on record | 13 |
| DOI/NPS, Greenbelt Parklocation not on record | 13 |
| Norfolk, US | 12 |
| GAlocation not on record | 12 |
| WINlocation not on record | 12 |
| Phoenix, US | 12 |
| Victoria, CA | 12 |
| Odawara, JP | 11 |
| Columbia, US | 11 |
| Pittsburg, US | 11 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 10 |
| DULlocation not on record | 10 |
| Richmond, US | 10 |
| Provincia di Livornolocation not on record | 10 |
| Logan, US | 9 |
| Missoula, US | 9 |
| Durham, US | 9 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 9 |
| Portland, US | 9 |
| Spearfish, US | 9 |
| Claremont, US | 9 |
| Oswego, US | 8 |
| Wellington, NZ | 8 |
| Staten Island, US | 8 |
| Jena Microbial Resource Collectionlocation not on record | 8 |
| Davenport, US | 8 |
| EL PASO, US | 8 |
| US | 8 |
| CASlocation not on record | 8 |
| Boise, US | 7 |
| Weber State Universitylocation not on record | 7 |
| Royal Botanical Gardenslocation not on record | 7 |
| SZUlocation not on record | 7 |
| Fairfax, US | 7 |
| Riverside, US | 7 |
| University of Southern Mississippilocation not on record | 7 |
| Caldwell, US | 7 |
| Millersville, US | 6 |
| Wlocation not on record | 6 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 6 |
| Lubbock, US | 6 |
| Kirksville, US | 6 |
| Ypsilanti, US | 6 |
| Mohonk Preservelocation not on record | 6 |
| Keene State Universitylocation not on record | 6 |
| Little Rock, US | 5 |
| Rotorua, NZ | 5 |
| Mlocation not on record | 5 |
| Clemson, US | 5 |
| AUAlocation not on record | 5 |
| Zürich, CH | 5 |
| Mount Pleasant, US | 5 |
| Washington, US | 5 |
| Maryland Department of Natural Resourceslocation not on record | 5 |
| Hudson, US | 5 |
| New Brunswick, US | 4 |
| Cambridge, US | 4 |
| Trois-Rivières, CA | 4 |
| Edmonton, CA | 4 |
| Science Museum of Minnesotalocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Pocatello, US | 4 |
| GB | 4 |
| Tilburg, NL | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Chicago, US | 4 |
| Davis, US | 3 |
| Paris, FR | 3 |
| Moscow State Universitylocation not on record | 3 |
| Oskarshamn, SE | 3 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| Beijing, CN | 3 |
| Waverly, US | 3 |
| BFLlocation not on record | 3 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 3 |
| Delaware State University, Claude E. Phillips Herbariumlocation not on record | 3 |
| Springfield, US | 3 |
| Northridge, US | 3 |
| BIO-UNIPIlocation not on record | 3 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 3 |
| Black Rock Forest Consortiumlocation not on record | 3 |
| University of Wisconsinlocation not on record | 3 |
| Karlsruhe, DE | 3 |
| Bando, JP | 3 |
| Nijmegen, NL | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Bozeman, US | 2 |
| Provo, US | 2 |
| Durham, US | 2 |
| Valdosta State Universitylocation not on record | 2 |
| Russellville, US | 2 |
| State University of New York, College at Oneontalocation not on record | 2 |
| Macomb, US | 2 |
| Tacoma, US | 2 |
| IDElocation not on record | 2 |
| Henderson, US | 2 |
| University of South Carolina Salkehatchielocation not on record | 2 |
| Zürich, CH | 2 |
| Bothell, US | 2 |
| Minia, EG | 2 |
| Mexico City, MX | 2 |
| Angwin, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Cheney, US | 2 |
| Brookings, US | 2 |
| Santa Barbara, US | 1 |
| Jefferson City, US | 1 |
| Armidale, AU | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| GZUlocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Barcelona, ES | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Kunming, CN | 1 |
| Bend, US | 1 |
| Whitehorse, CA | 1 |
| KIRMlocation not on record | 1 |
| Henderson State Universitylocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| LINUlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Conway, US | 1 |
| Arcata, US | 1 |
| University of Western Ontariolocation not on record | 1 |
| Hokkaido University Botanic Gardenlocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Wuhan, CN | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| KNFHClocation not on record | 1 |
| Hamilton, US | 1 |
| Decorah, US | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| GJOlocation not on record | 1 |
| Xiamen, CN | 1 |
| Pondicherry, IN | 1 |
| Fukushima Universitylocation not on record | 1 |
| Conway, US | 1 |
| San Diego, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
216 institutions · 6 954 of 7 083 vouchered records shown · 129 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA27 detections
Where the DNA of Carex vulpinoidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found27
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 27 detections have coordinates
Open the map2 countries0
Managed boreal mixedwood stand
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.4 °C 17.7–23.2
Seasonal swing summer↔winter26.8 °C
Max temp (day)24.5 °C 21.1–28.5
Min temp (night)15.8 °C 13.8–18.7
Precipitation103 mm/mo 63.7–147
Air humidity57.9 % 57.1–61.3
Moisture balance-42.7 mm/mo -108–-4.20
Vapour deficit929 Pa 782–1,203
Wind speed3.50 m/s 2.30–5.60
Cloud cover39.1 % 36.0–46.2
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.