Carex vulcani

Hochst. ex Seub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records1 985

Data sources8

Biological traits17

DNA specimens8

eDNA detections5

Sources8 archives

Databases and archives Carex vulcani's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 985 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF1 985 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Carex vulcani is a species of sedge native to the Azores generally found above 300 m altitude.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.7 m

Seed mass0.8 mg

Life cycle & reproduction7

Dispersal typewater

Life formperennial or rhizomatous geophyte

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Self fertilizationabsent

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits2

Plant support typefree-standing

Seeds per fruit101-1000

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex vulcani has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences3

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN762883.1 ↗594 bpPortugal

ACGT

CGACCGTCGAACACGTGACCGAACGCTGCCGCGGAGGCGCTCGCCGCCTCCTCGGCCCCACCGGCCTCCTCCCTCTCGCCCCCCGGGCGC …

Carex vulcani isolate spm00007856 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 985 records

Wild obs. + sensor1 902

Museum / vouchered13

Other70

Origin

Native104

Range

Area of Occupancy AOO860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 110≤1 km 1 774≤10 km 9>10 km 6

1 899 georeferenced · 3 without coordinates

Open the mapobservation + sensor1 902

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CICYTEXlocation not on record	6
Finnish Museum of Natural Historylocation not on record	3
Badajoz, ES	1
Chengdu, CN	1

4 institutions · 11 of 13 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Carex vulcani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 13.8–17.5

Seasonal swing summer↔winter22.4 °C

Max temp (day)20.5 °C 17.5–21.4

Min temp (night)10.4 °C 9.70–13.3

Precipitation70.4 mm/mo 60.3–80.2

Air humidity58.3 % 57.7–59.2

Moisture balance-41.9 mm/mo -64.5–-28.0

Vapour deficit804 Pa 684–829

Wind speed2.90 m/s 2.60–4.40

Cloud cover41.8 % 41.2–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carex vulcani

At a glance

Sources8 archives

Size & morphology2

Life cycle & reproduction7

Diet & foraging1

Habitat & environment5

Other traits2

At a glance

Record type1 985 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 985 records