Carex vesiculosa — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records43

Data sources4

Biological traits11

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Carex vesiculosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF43 records

DNA & barcodingNCBIsequences

01Narrative

Carex vesiculosa est une espèce de plantes du genre Carex et de la famille des Cyperaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 000 m

Elevation min1 700 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex vesiculosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN762021.1 ↗666 bpBhutan

ACGT

TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGCCTTTCCGAAAACACGACCGTCGAACACGTGACTGAATGCT …

Carex vesiculosa isolate spm00005871 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type43 records

Museum / vouchered43

Range

Area of Occupancy AOO108 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 43 records without

Open the institutions mapphysical evidence43

10Collections & institutions

Institution	Specimens
Herbarium of the Department of Botany, University of Tokyolocation not on record	9
University of Stellenboschlocation not on record	1

2 institutions · 10 of 43 vouchered records shown · 33 without an institution code