Carex utriculata
Boott · speciesAt a glance
Occurrence records9 448
Data sources13
Biological traits102
DNA specimens38
eDNA detections27
Sources13 archives
Databases and archives Carex utriculata's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 437 records↗
OBISOcean Biodiversity Information System11 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources102 traits
Occurrence & distributionGBIF · OBIS9 448 records
Environmental DNA1 datasets · 4 countries27 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB2n = 82
01Narrative
Carex utriculata is a species of sedge known as Northwest Territory sedge and common yellow lake sedge.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology7
Leaf size1 016 mm²
Plant height1.1 m
⚠ sources differ — GIFT: 1.1 m · USDA: 1.07 m · TRY: 0.537 m
Plant height max1.5 m
Plant height min0.5 m
Seed mass1.08 mg
⚠ sources differ — TRY: 1.08 mg · GIFT: 0.985 mg
Seed mass max1.08 mg
Seed mass min0.89 mg
Life cycle & reproduction27
After harvest regrowth rateSlow
Bloom periodMid Summer
Coppice potentialNo
Flower colourgreen
Flower conspicuousNo
Flowering endAug
Flowering startJun
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifeform raunkiaer detailedgeophyte
Lifespan categoryModerate
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Growth form USDARhizomatous
Habitat GIFTlakes, rivers, swamps
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typenon-mycorrhizal
Root depth min8 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry21
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min100 days
Leaf c421 mg/g
Leaf n10.78 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Precipitation max60 in
Precipitation min18 in
Salinity toleranceLow
Shade toleranceHigh
Soil pH max7.7 pH
Soil pH min5.7 pH
Specific leaf area (SLA)11.56 mm²/mg
Temperature min-43 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityContracting Only
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max18 000 per acre
Planting density min11 000 per acre
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex utriculata has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes6
GenBank sequences10
eDNA detections27
Countries5
The DNA barcodea real sequence read deposited for this species
TCGTTGCCTTTCCAGAAACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCTNGCCGCCTCCTCGGCCCCGCCGGCCTCCT …
Carex utriculata isolate B774 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6★rbcLa★trnL-F★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Carex utriculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 82 n = 41
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 821×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
n 411×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Cayouette, J. 1997. IOPB chromosome data 12. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 28: 13–14.
08Occurrence & distribution
Record type9 448 records
Wild obs. + sensor3 144
Museum / vouchered6 282
Cultivated / captive22
Origin
Native2
Range
Area of Occupancy AOO27 152 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 1 929≤1 km 296≤10 km 71>10 km 162
2 458 georeferenced · 686 without coordinates
Open the mapobservation + sensor3 144
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 379≤1 km 1 101≤10 km 1 244>10 km 178
2 902 georeferenced · 3 380 without coordinates
Open the institutions mapphysical evidence6 282
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 22 records without
Open the mapnot free-living22
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions98 of 167 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Victoria, CA | 399 |
| Madison, US | 347 |
| Moscow State Universitylocation not on record | 345 |
| St. Paul, US | 335 |
| WTUlocation not on record | 264 |
| Moscow, US | 218 |
| University of Alberta Museumslocation not on record | 216 |
| Vancouver, CA | 192 |
| Ann Arbor, US | 186 |
| Pullman, US | 169 |
| Irkutsk State Universitylocation not on record | 166 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 162 |
| Missoula, US | 148 |
| Chicago, US | 139 |
| Corvallis, US | 138 |
| Chongqing Museumlocation not on record | 120 |
| Denver, US | 119 |
| Flagstaff, US | 112 |
| University of New Hampshirelocation not on record | 105 |
| Université Lavallocation not on record | 98 |
| WINlocation not on record | 97 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 90 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 87 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 83 |
| Albuquerque, US | 79 |
| Burlington, US | 71 |
| Toronto, CA | 70 |
| Davis, US | 65 |
| Montréal, CA | 63 |
| Bozeman, US | 63 |
| Claremont, US | 62 |
| Boise, US | 58 |
| Logan, US | 49 |
| University of Toronto Mississaugalocation not on record | 48 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 41 |
| Bronx, US | 39 |
| Wuzhou, CN | 39 |
| CASlocation not on record | 38 |
| Green Bay, US | 37 |
| Caldwell, US | 36 |
| Rocky Mountain Biological Laboratorylocation not on record | 36 |
| Bloomington, US | 35 |
| Yukon Universitylocation not on record | 34 |
| Saint John, CA | 32 |
| University of Stellenboschlocation not on record | 31 |
| Arcata, US | 31 |
| Provo, US | 30 |
| Phoenix, US | 30 |
| ASUlocation not on record | 28 |
| DOI/NPS, Greenbelt Parklocation not on record | 28 |
| DULlocation not on record | 26 |
| International Salmonella Centre (W.H.O.)location not on record | 25 |
| Bend, US | 25 |
| Riverside, US | 24 |
| Durango, US | 24 |
| Pocatello, US | 24 |
| Oregon State Universitylocation not on record | 24 |
| Anchorage, US | 21 |
| Québec, CA | 20 |
| Durham, US | 20 |
| Philadelphia, US | 19 |
| Saint Louis, US | 18 |
| USFS/BHSClocation not on record | 16 |
| Acadia Universitylocation not on record | 14 |
| EL PASO, US | 12 |
| SLU Artdatabankenlocation not on record | 12 |
| Museum of the Rockieslocation not on record | 12 |
| Orem, US | 11 |
| Chadron, US | 10 |
| Institute of the biological problems of the North FEB RASlocation not on record | 10 |
| University of Wisconsinlocation not on record | 10 |
| San Diego, US | 9 |
| McWane Science Centerlocation not on record | 9 |
| Santa Barbara, US | 9 |
| Portland, US | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Maryland Department of Natural Resourceslocation not on record | 8 |
| Whitehorse, CA | 8 |
| Montréal, CA | 8 |
| INFlocation not on record | 7 |
| AUAlocation not on record | 6 |
| IWEP FEB RASlocation not on record | 6 |
| Dover, US | 6 |
| San Angelo, US | 6 |
| Christchurch, NZ | 6 |
| San Luis Obispo, US | 6 |
| SEFlocation not on record | 5 |
| Lincoln, US | 5 |
| University of Wisconsinlocation not on record | 5 |
| US | 4 |
| University of Lethbridgelocation not on record | 4 |
| Chicago, US | 4 |
| Mississippi State, US | 4 |
| Mount Pleasant, US | 4 |
| Morgantown, US | 4 |
| STNFlocation not on record | 3 |
| Henderson, US | 3 |
| Delaware State University, Claude E. Phillips Herbariumlocation not on record | 3 |
| Elikins, US | 3 |
| Truckee, US | 3 |
| Weber State Universitylocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| Cheney, US | 3 |
| Spearfish, US | 3 |
| Tampa, US | 3 |
| New Haven, US | 3 |
| Uppsala, SE | 3 |
| Chapel Hill, US | 3 |
| Taipei, TW | 2 |
| Davenport, US | 2 |
| Minia, EG | 2 |
| Auckland, NZ | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| CSBSJUlocation not on record | 2 |
| Bothell, US | 2 |
| Royal Alberta Museumlocation not on record | 2 |
| Dekalb, US | 2 |
| BClocation not on record | 2 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 2 |
| Pittsburg, US | 2 |
| Olocation not on record | 2 |
| US | 2 |
| Yellowstone National Park Herbariumlocation not on record | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Guasave, MX | 2 |
| Juriquilla, MX | 2 |
| VALElocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Bureau of Land Management, Medford District Officelocation not on record | 2 |
| Jackson, US | 1 |
| Grand Junction, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| Kew, GB | 1 |
| Ypsilanti, US | 1 |
| Columbia, US | 1 |
| US | 1 |
| University of Manitoba Herbariumlocation not on record | 1 |
| Cambridge, US | 1 |
| Santa Cruz, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| GAlocation not on record | 1 |
| Los Angeles, US | 1 |
| GB | 1 |
| Fort Worth, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| KNFYlocation not on record | 1 |
| DOI/NPS, Olympic National Parklocation not on record | 1 |
| Cincinnati, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Salvador, BR | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| BRNUlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| San Jose, US | 1 |
| Austin, US | 1 |
| Fargo, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Northridge, US | 1 |
| Fort Bragg, US | 1 |
| HJAEFlocation not on record | 1 |
| Austin, US | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Bangkok, TH | 1 |
| Beijing, CN | 1 |
167 institutions · 6 155 of 6 282 vouchered records shown · 125 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA27 detections
Where the DNA of Carex utriculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found27
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 27 detections have coordinates
Open the map4 countries0
Slightly undulating, sloping area with dry u…Moist soil directly next to Yellowstone River
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.4 °C 11.8–17.7
Seasonal swing summer↔winter24.9 °C
Max temp (day)19.7 °C 16.4–23.4
Min temp (night)7.90 °C 6.50–13.2
Precipitation98.3 mm/mo 37.7–119
Air humidity58.0 % 50.0–61.7
Moisture balance-18.7 mm/mo -98.6–21.7
Vapour deficit738 Pa 567–886
Wind speed2.80 m/s 2.20–4.30
Cloud cover41.1 % 23.1–52.0
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.