Carex uruguensis

Boeckeler · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records46

Data sources4

Biological traits13

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Carex uruguensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF46 records

DNA & barcodingNCBIsequences

01Narrative

Carex uruguensis est une espèce de plantes du genre Carex et de la famille des Cyperaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTCampo Limpo

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex uruguensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN761945.1 ↗680 bpArgentina

ACGT

GGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGCCTCTCGAAAAACACGACCGTTGCACCCGT …

Carex uruguensis isolate spm00007367 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type46 records

Wild obs. + sensor6

Museum / vouchered40

Origin

Native9

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Isidro, AR	7
San Jose State University, Museum of Birds and Mammalslocation not on record	6
Departamento de Geologia, Universidad de Chilelocation not on record	3
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	3
Bronx, US	2
Buenos Aires, AR	2
University of Stellenboschlocation not on record	2
Universidade Federal de Santa Catarinalocation not on record	2
Saint Louis, US	2
UFSClocation not on record	2
UFPElocation not on record	1
Paris, FR	1
Chicago, US	1
CJBGlocation not on record	1
La Paz, BO	1
Porto Alegre, BR	1
Universidade Federale do Rio Grande do Sullocation not on record	1
PUC-RSlocation not on record	1

18 institutions · 39 of 40 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)