Carex unilateralis

Mack. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records255

Data sources9

Biological traits14

DNA specimens10

eDNA detections8

Sources9 archives

Databases and archives Carex unilateralis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility255 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF255 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Carex unilateralis est une espèce de plantes du genre Carex et de la famille des Cyperaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.478 mg

Seed mass max0.5 mg

Seed mass min0.459 mg

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex unilateralis has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences9

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG216561.1 ↗348 bpUSA · 2001

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …

Carex unilateralis voucher B0985 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL3★rbcLa★ITS6★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type255 records

Wild obs. + sensor62

Museum / vouchered193

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 29≤1 km 14≤10 km 3>10 km 2

48 georeferenced · 14 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 6≤1 km 60≤10 km 32>10 km 1

99 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence193

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	39
WTUlocation not on record	33
Victoria, CA	20
Portland, US	18
Pullman, US	16
Bronx, US	12
Vancouver, CA	7
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	5
University of Stellenboschlocation not on record	3
Moscow, US	3
Angwin, US	2
Provo, US	2
Ann Arbor, US	2
Davis, US	2
Boise, US	2
Hokkaido University Botanic Gardenlocation not on record	2
Whitehorse, CA	1
Mexico City, MX	1
Tampa, US	1
Bend, US	1
University of British Columbialocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Henderson, US	1
Museum of the Rockieslocation not on record	1
Tacoma, US	1
Montréal, CA	1
Phoenix, US	1
Albuquerque, US	1
Christchurch, NZ	1
University of Washingtonlocation not on record	1
Santa Barbara, US	1
ASUlocation not on record	1
San Angelo, US	1

33 institutions · 185 of 193 vouchered records shown · 8 without an institution code

09Environmental DNA8 detections

Where the DNA of Carex unilateralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 8.80–15.4

Seasonal swing summer↔winter14.0 °C

Max temp (day)16.8 °C 12.2–21.3

Min temp (night)7.80 °C 5.10–10.5

Precipitation93.0 mm/mo 84.7–101

Air humidity59.5 % 58.7–60.2

Moisture balance-14.7 mm/mo -46.4–16.9

Vapour deficit597 Pa 459–736

Wind speed2.50 m/s 2.20–2.70

Cloud cover42.9 % 42.5–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)