Carex uncinata

L.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records4 878

Data sources8

Biological traits38

DNA specimens0

eDNA detections2

Sources8 archives

Databases and archives Carex uncinata's data was compiled from.

GBIFGlobal Biodiversity Information Facility4 878 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources38 traits

Occurrence & distributionGBIF4 878 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GIFT2n = 88

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length max2.5 mm

Fruit length min2.3 mm

Leaf length max500 mm

Leaf width3 mm

Leaf width max6 mm

Leaf width min2 mm

Plant height0.3 m

⚠ sources differ — GIFT: 0.3 m · TRY: 0.321 m

Plant height max0.9 m

Plant height min0.2 m

Seed mass0.86 mg

Seed mass max1.29 mg

Seed mass min0.42 mg

Seed volume0.77 mm³

Seed volume max0.77 mm³

Seed volume min0.77 mm³

Life cycle & reproduction10

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeunspecialized

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoids

Habitat GIFTrain forest

Mycorrhiza type0.357238862

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex uncinata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF284988.1 ↗604 bp

ACGT

TTGCCTCTCGAAAAACACGACCGTTGCACGCGTGACAGAATGCTGCCGGGGAGGCGCCCGCCGCCTCCCCGGCCCCGCCGGCCTCTTCCC …

Uncinia uncinata internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GIFT

The complete instruction manual Carex uncinata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 88 n = 44

Chromosome records88–882n range88median88mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 885×CCDB · new-zealand · CCDB · cyper-only · CCDB · ipcn-api-dl +2

CCDB · new-zealand

CCDB · cyper-only — Beuzenberg, E. J.1970

CCDB · ipcn-api-dl — de Lange, P. J. & B. G. Murray. 2002. Contributions to a chromosome atlas of the New Zealand flora---37. Miscellaneous families. New Zealand J. Bot. 40: 1–23.

CCDB · book-ipcn67-71 — BEUZENBERG, E.J. 1970. Contributions to a chromosome atlas of the New Zealand flora. 14. Uncinia (Cyperaceae). New Zealand J. Bot. 8: 260-263.

GIFT · GIFT (floras)

08Occurrence & distribution

Record type4 878 records

Wild obs. + sensor4 082

Museum / vouchered796

Origin

Introduced3

Range

Area of Occupancy AOO10 692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 3 886≤1 km 95≤10 km 15>10 km 9

4 005 georeferenced · 77 without coordinates

Open the mapobservation + sensor4 082

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 12≤1 km 11≤10 km 10>10 km 2

35 georeferenced · 761 without coordinates

Open the institutions mapphysical evidence796

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	519
Wellington, NZ	211
Rotorua, NZ	28
Auckland, NZ	17
Hobart, AU	8
Canberra, AU	5
Moscow State Universitylocation not on record	2
Museo Entomologico de Leonlocation not on record	2
University of Stellenboschlocation not on record	2
Mount Annan, AU	1
Palmerston North, NZ	1

11 institutions · 796 of 796 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Carex uncinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carex uncinata

At a glance

Sources8 archives

Size & morphology15

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 878 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 878 records