Carex tuckermanii

Boott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records977

Data sources12

Biological traits19

DNA specimens8

eDNA detections6

Sources12 archives

Databases and archives Carex tuckermanii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility975 records↗

OBISOcean Biodiversity Information System2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.49 Gbp↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF · OBIS977 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceGoaT489 Mbp

01Narrative

Carex tuckermanii, Tuckerman's sedge, is a species of Carex that is native to North America. It is a perennial.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.378 m

Seed mass5.5 mg

Seed mass max5.5 mg

Seed mass min5.5 mg

Life cycle & reproduction4

Deciduousnessn.d.

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)227 mg/g

Leaf n19.04 mg/g

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex tuckermanii has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG216443.1 ↗353 bpUSA · 2002

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …

Carex tuckermanii voucher B0740 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Carex tuckermanii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size489 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Carex tuckermanii0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type977 records

Wild obs. + sensor869

Museum / vouchered104

Cultivated / captive4

Range

Area of Occupancy AOO2 984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 476≤1 km 71≤10 km 21>10 km 144

712 georeferenced · 157 without coordinates

Open the mapobservation + sensor869

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence104

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint John, CA	31
Montréal, CA	15
University of Toronto Mississaugalocation not on record	13
Université Lavallocation not on record	11
Tampa, US	8
Christchurch, NZ	4
Vancouver, CA	3
Auckland, NZ	2
Uppsala, SE	1
MeiseBGlocation not on record	1
Universite de Montreal, L'Herbier Marie-Victorinlocation not on record	1
LDlocation not on record	1
BClocation not on record	1
Beijing, CN	1
University of Lethbridgelocation not on record	1
Paris, FR	1
Millersville, US	1
Chicago, US	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
International Salmonella Centre (W.H.O.)location not on record	1
Kew, GB	1

21 institutions · 100 of 104 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Carex tuckermanii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 0.5–20.8

Seasonal swing summer↔winter30.7 °C

Max temp (day)24.7 °C 4.00–25.9

Min temp (night)15.7 °C -2.10–16.7

Precipitation80.8 mm/mo 59.4–110

Air humidity59.6 % 58.9–64.0

Moisture balance-25.3 mm/mo -52.7–-6.50

Vapour deficit942 Pa 404–1,011

Wind speed3.30 m/s 2.80–5.10

Cloud cover43.6 % 37.5–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)