Carex trinervis

Degl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records12 253

Data sources7

Biological traits33

DNA specimens5

eDNA detections3

Sources7 archives

Databases and archives Carex trinervis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 253 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF12 253 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 82

01Narrative

Drienervige zegge is een in België en Nederland oorspronkelijk inheemse, grasachtige plant die behoort tot de cypergrassenfamilie (Cyperaceae). De soort staat op de Nederlandse Rode lijst van planten als zeldzaam voorkomend en stabiel of toegenomen. De plant komt voor langs de Atlantische kust van Europa van Denemarken tot Portugal.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology7

Leaf mass27.61 mg

Leaf size917 mm²

Plant height0.25 m

⚠ sources differ — GIFT: 0.25 m · LEDA: 0.25 m · TRY: 0.275 m

Plant height generative0.25 m

Plant height max0.3 m

Plant height min0.1 m

Seed mass0.277 mg

Life cycle & reproduction12

Deciduousnessn.d.

⚠ sources differ — TRY: n.d. · GIFT: evergreen

Dehiscenceindehiscent

Dispersal typewater

Flowering endMay

Flowering startApr

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formcryptophyte

Reproduction asexualabsent

Seed number98.5

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typeachene

Growth formherb

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)268 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)24.19 mm²/mg

⚠ sources differ — TRY: 24.19 mm²/mg · LEDA: 18.47 mm²/mg · GIFT: 18.47 mm²/mg

Other traits2

Diaspore typeone-seeded generative dispersule

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex trinervis has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences10

eDNA detections3

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMN762815.1 ↗596 bpSpain

ACGT

GCCTCTCCAGAAACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCTTGCCGCCTTCTCGGCCCCACCGGCCTCCTCCCTC …

Carex trinervis isolate spm00003778 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex trinervis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 82 n = 41

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 821×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 28

n 421×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Luceño, M. & C. Aedo. 1994. Taxonomic revision of the Iberian species of Carex L. section Phacocystis Dumort. (Cyperaceae). Bot. J. Linn. Soc. 114: 183–214.

08Occurrence & distribution

Record type12 253 records

Wild obs. + sensor11 467

Museum / vouchered786

Origin

Native36

Range

Area of Occupancy AOO2 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 171≤1 km 4 700≤10 km 1 500>10 km 2

6 373 georeferenced · 5 094 without coordinates

Open the mapobservation + sensor11 467

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 19≤1 km 119≤10 km 130>10 km 3

271 georeferenced · 515 without coordinates

Open the institutions mapphysical evidence786

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussel, BE	133
MeiseBGlocation not on record	82
South Kensington, GB	29
LDlocation not on record	19
DBF-NHMDlocation not on record	8
Entomological Society of Latvialocation not on record	6
Oskarshamn, SE	3
Wlocation not on record	3
Olocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	2
Xiamen, CN	2
MAlocation not on record	2
CJBGlocation not on record	2
Naturalis Biodiversity Centerlocation not on record	2
ISAlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Tilburg, NL	2
València, ES	2
Berlin, DE	1
NMBU:MINAlocation not on record	1
BRNUlocation not on record	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Nijmegen, NL	1
Alicante, ES	1
Badajoz, ES	1
Stockholm, SE	1
Barcelona, ES	1
Denver, US	1

28 institutions · 314 of 786 vouchered records shown · 472 without an institution code

09Environmental DNA3 detections

Where the DNA of Carex trinervis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 15.3–17.1

Seasonal swing summer↔winter14.3 °C

Max temp (day)19.4 °C 19.0–19.8

Min temp (night)12.6 °C 11.0–14.2

Precipitation80.0 mm/mo 78.2–81.8

Air humidity62.1 % 61.4–62.7

Moisture balance-40.9 mm/mo -42.0–-39.8

Vapour deficit701 Pa 671–730

Wind speed3.60 m/s 2.90–4.30

Cloud cover45.6 % 40.4–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carex trinervis

At a glance

Sources7 archives

Size & morphology7

Life cycle & reproduction12

Diet & foraging2

Habitat & environment6

Physiology & chemistry4

Other traits2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type12 253 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type12 253 records