Carex trifida

Cav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records453

Data sources8

Biological traits24

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Carex trifida's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility453 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF453 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 60

01Narrative

Carex trifida, the mutton-bird sedge, is a species of flowering plant in the family Cyperaceae, native to Macquarie Island of Australia, the South Island, the Antipodes Islands, and the Chatham Islands of New Zealand, southern Chile, and the Falkland Islands. There are a number of cultivars, including 'Rekohu Sunrise', 'Glauca', and 'Chatham Blue'.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit length5 mm

Leaf length1 000 mm

Leaf width10.5 mm

Plant height1 m

Seed mass0.67 mg

Seed mass max0.67 mg

Seed mass min0.67 mg

Life cycle & reproduction4

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeutricle

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Mycorrhiza type0.001460331

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex trifida has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY699620.1 ↗713 bpNew Zealand

ACGT

GGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCCGCTGCCTTTCCAGAAACACGACCGTCGAACACGTGACA …

Carex trifida isolate 00603F 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex trifida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Chromosome records60–602n range60median60mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 603×CCDB · new-zealand · CCDB · cyper-only · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · cyper-only — Moore, D. M.1960

CCDB · ipcn-api-dl — de Lange, P. J. & B. G. Murray. 2002. Contributions to a chromosome atlas of the New Zealand flora---37. Miscellaneous families. New Zealand J. Bot. 40: 1–23.

08Occurrence & distribution

Record type453 records

Wild obs. + sensor224

Museum / vouchered227

Cultivated / captive2

Range

Area of Occupancy AOO952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 125≤1 km 46≤10 km 9>10 km 11

191 georeferenced · 33 without coordinates

Open the mapobservation + sensor224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 4≤1 km 17≤10 km 12>10 km 3

36 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence227

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	113
Wellington, NZ	51
Auckland, NZ	18
Hobart, AU	12
QVMAGlocation not on record	10
Museo Entomologico de Leonlocation not on record	5
Canberra, AU	5
Buenos Aires, AR	3
Kew, GB	3
AASlocation not on record	2
Montréal, CA	1
South Kensington, GB	1
Palmerston North, NZ	1
AADClocation not on record	1
Adelaide, AU	1

15 institutions · 227 of 227 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)