Carex torta

Boott ex Tuck. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records840

Data sources7

Biological traits90

DNA specimens10

eDNA detections9

Sources7 archives

Databases and archives Carex torta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility840 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources90 traits

Occurrence & distributionGBIF840 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Carex torta adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex torta sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Boott ex Tuck..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology1

Plant height0.85 m

Life cycle & reproduction25

After harvest regrowth rateSlow

Bloom periodLate Spring

Coppice potentialNo

Flower colourgreen

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDASlow

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsYes

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateSlow

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Growth form USDARhizomatous

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min8 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry19

Anaerobic toleranceHigh

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceLow

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min90 days

Moisture useMedium

Nitrogen fixation levelNone

Precipitation max50 in

Precipitation min32 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceLow

Soil pH max7 pH

Soil pH min5 pH

Temperature min-33 °F

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max4 800 per acre

Planting density min2 700 per acre

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex torta has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences5

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG215759.1 ↗245 bpCanada · 1974

ACGT

GAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGTTGCCTAACTAACGGCAAAGATGCGGACATT …

Carex torta voucher 45185HIM 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLa★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type840 records

Wild obs. + sensor577

Museum / vouchered263

Range

Area of Occupancy AOO2 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 308≤1 km 35≤10 km 17>10 km 104

464 georeferenced · 113 without coordinates

Open the mapobservation + sensor577

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 1≤1 km 20≤10 km 93>10 km 26

140 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence263

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Acadia Universitylocation not on record	33
University of New Hampshirelocation not on record	33
Saint John, CA	24
University of Stellenboschlocation not on record	23
Longwood Universitylocation not on record	22
Madison, US	13
New Haven, US	10
McWane Science Centerlocation not on record	9
Wuzhou, CN	8
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	6
Oswego, US	5
Bloomington, US	3
BClocation not on record	3
Millersville, US	3
Kew, GB	2
Keene State Universitylocation not on record	2
Auckland, NZ	2
Christchurch, NZ	2
EL PASO, US	2
Provo, US	2
Durham, US	2
Taipei, TW	1
Jena Microbial Resource Collectionlocation not on record	1
State University of New York, College at Oneontalocation not on record	1
Northridge, US	1
Moscow State Universitylocation not on record	1
ASUlocation not on record	1
Delaware State University, Claude E. Phillips Herbariumlocation not on record	1
University of Guelph, OAC Herbariumlocation not on record	1
Miami, US	1
Chicago, US	1
Montréal, CA	1

32 institutions · 220 of 263 vouchered records shown · 43 without an institution code

09Environmental DNA9 detections

Where the DNA of Carex torta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 9.10–13.6

Seasonal swing summer↔winter28.1 °C

Max temp (day)16.0 °C 13.4–18.6

Min temp (night)7.10 °C 5.90–8.30

Precipitation92.1 mm/mo 90.3–93.9

Air humidity58.1 % 57.4–58.9

Moisture balance4.30 mm/mo -31.1–39.7

Vapour deficit574 Pa 479–669

Wind speed3.40 m/s 3.00–3.70

Cloud cover54.1 % 46.7–61.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)