Carex testacea

Sol. ex Boott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records840

Data sources9

Biological traits16

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Carex testacea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility840 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources16 traits

Occurrence & distributionGBIF840 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 52

01Narrative

Carex testacea, the orange New Zealand sedge, is a species of flowering plant in the family Cyperaceae, native to New Zealand. Prized for its colourful foliage, which provides both summer and winter interest, it is widely available commercially.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology3

Seed mass0.911 mg

Seed mass max0.91 mg

Seed mass min0.91 mg

Life cycle & reproduction4

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex testacea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY699621.1 ↗700 bpNew Zealand

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCCGCTGCCTTTCCAGAAACACGACCGTCGAACACGTGACAGAAT …

Carex testacea isolate 00603E 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex testacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Chromosome records52–522n range52median52mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 522×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — de Lange, P. J. & B. G. Murray. 2002. Contributions to a chromosome atlas of the New Zealand flora---37. Miscellaneous families. New Zealand J. Bot. 40: 1–23.

08Occurrence & distribution

Record type840 records

Wild obs. + sensor261

Museum / vouchered577

Cultivated / captive2

Origin

Native1

Introduced3

Range

Area of Occupancy AOO2 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 87≤1 km 11≤10 km 11>10 km 7

116 georeferenced · 145 without coordinates

Open the mapobservation + sensor261

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 13≤1 km 13≤10 km 9>10 km 9

44 georeferenced · 533 without coordinates

Open the institutions mapphysical evidence577

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	280
Auckland, NZ	155
Wellington, NZ	96
Rotorua, NZ	21
Hobart, AU	8
Chicago, US	5
Mount Annan, AU	3
Museo Entomologico de Leonlocation not on record	2
Vancouver, CA	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Brisbane, AU	1
South Kensington, GB	1
Canberra, AU	1
QVMAGlocation not on record	1
Palmerston North, NZ	1

15 institutions · 577 of 577 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Carex testacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)