Carex teres — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records15

Data sources3

Biological traits10

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Carex teres's data was compiled from.

GBIFGlobal Biodiversity Information Facility15 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF15 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max4 000 m

Elevation min2 000 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex teres has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMW398516.1 ↗598 bpIndia · 1992

ACGT

TTGCCTTTCCAGAAACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCTCGCCGCCTCCTCGGCCCCACCGGCCTCCTCCC …

Carex teres isolate TER_IND-WB_WSU_1376 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type15 records

Museum / vouchered15

Range

Area of Occupancy AOO40 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	2
Cambridge, US	1
Edinburgh, GB	1

3 institutions · 4 of 15 vouchered records shown · 11 without an institution code