Carex tenax

Chapm. ex Dewey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records137

Data sources7

Biological traits14

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Carex tenax's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Carex tenax adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex tenax sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Chapm. ex Dewey.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass5.59 mg

Seed mass max5.59 mg

Seed mass min5.59 mg

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex tenax has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK581428.1 ↗613 bpUSA

ACGT

CCGTTGCCTTTCCAGAAACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCTTGCCGCCTCCTCCGGCCCCGCCGGCCTCC …

Carex tenax isolate B703 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type137 records

Wild obs. + sensor42

Museum / vouchered95

Range

Area of Occupancy AOO372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 11≤1 km 4>10 km 17

32 georeferenced · 10 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 5

9 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	21
Jena Microbial Resource Collectionlocation not on record	19
Ann Arbor, US	9
Tampa, US	5
Tall Timbers Research Stationlocation not on record	5
Saint Louis, US	5
Miami, US	5
Austin, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Chicago, US	4
University of Stellenboschlocation not on record	3
BClocation not on record	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
University of Southern Mississippilocation not on record	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
Wlocation not on record	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Madison, US	1

18 institutions · 95 of 95 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Carex tenax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)