Carex sylvatica
Huds. · speciesAt a glance
Occurrence records329 382
Data sources9
Biological traits51
DNA specimens39
eDNA detections24
Sources9 archives
Databases and archives Carex sylvatica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility329 382 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics39 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources51 traits
Occurrence & distributionGBIF329 382 records
Environmental DNA1 datasets · 6 countries24 detections
DNA & barcodingBOLD · NCBI39 specimens
Genome at a glanceCCDB · GoaT · NCBI440 Mbp
01Narrative
La Laîche des bois est une espèce de plante de la famille des Cyperaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology16
Leaf mass29.75 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 677 mm² · GIFT: 677 mm²
Leaf width3 mm
Leaf width max3 mm
Leaf width min3 mm
Plant height0.425 m
⚠ sources differ — GIFT: 0.425 m · LEDA: 0.425 m · TRY: 0.18 m
Plant height generative0.35 m
Plant height max1 m
Plant height min0.3 m
Seed length3.91 mm
Seed mass1.54 mg
⚠ sources differ — TRY: 1.54 mg · LEDA: 1.65 mg · GIFT: 1.54 mg
Seed mass max1.67 mg
Seed mass min1.29 mg
Seed volume1.3 mm³
Seed volume max1.3 mm³
Seed volume min1.3 mm³
Life cycle & reproduction13
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJun
Flowering startMay
Life formperennial or rhizomatous geophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number736
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 275 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTforest
Mycorrhiza typedark-septate
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio28.77 g/g
Leaf c451 mg/g
Leaf dry-matter content (LDMC)311 mg/g
Leaf n15.49 mg/g
Leaf p1.2 mg/g
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)21.67 mm²/mg
⚠ sources differ — TRY: 21.67 mm²/mg · LEDA: 30.9 mm²/mg · GIFT: 30.9 mm²/mg
Other traits1
Diaspore typegenerative dispersule
05DNA & barcoding39 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex sylvatica has left across the world's sequence archives.
At a glance
DNA specimens39
Marker genes6
GenBank sequences10
eDNA detections24
Countries9
The DNA barcodea real sequence read deposited for this species
TCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAG …
Carex sylvatica isolate C058 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★ITS8★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Carex sylvatica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size440 100 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex sylvatica0.44 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 58 n = 29
Chromosome records46–622n range58median58mode19records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5816×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · iber-fl — Cytotaxonomic studies in Iberian and Macaronesian species of Carex (Cyperaceae). Luceo, M.Willdenowia22: 149-165(1992).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4357
CCDB · fl-europaea — Majovsky et al.,
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · book-ipcn75-78 — Hindakova 1976
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
CCDB · CromoCat 2015 — Luceño, M. (1992). Cytotaxonomic studies in Iberian and Macaronesian species of Carex (Cyperaceae). Willdenowia 22: 149-165.
CCDB · CromoCat 2015 — Rotreklová, O. & Bureš, P. & ?epka, R. & Grulich, V. & Šmarda, P. & Hralová, I. & Zedek, F.& Koutecký, T. (2011). Chromosome numbers of Carex Preslia 83: 25–58
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
2n 462×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Stoeva, M. P. 1985. Chromosome numbers of Bulgarian angiosperms. Fitologija 30: 78–79.
CCDB · CromoCat 2015 — Stoeva, M. P. (1985). Chromosome numbers of Bulgarian angiosperms. Fitologija (Sofia) 30: 78-79.
2n 621×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Hayirlioğlu-Ayaz, S., A. Olgun & O. Beyazoğlu. 2001. Chromosome numbers of some Carex species from northeast Anatolia. Biologia (Bratislava) 56: 381–387.
n 293×CCDB · iber-fl · CCDB · Cave1956 · CCDB · CromoCat 2015
CCDB · iber-fl — Cytotaxonomic studies in Iberian and Macaronesian species of Carex (Cyperaceae). Luceo, M.Willdenowia22: 149-165(1992).
CCDB · Cave1956 — Davies a, b
CCDB · CromoCat 2015 — Luceño, M. (1992). Cytotaxonomic studies in Iberian and Macaronesian species of Carex (Cyperaceae). Willdenowia 22: 149-165.
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness75.2% BUSCO
08Occurrence & distribution
Record type329 382 records
Wild obs. + sensor313 434
Museum / vouchered10 972
Cultivated / captive856
Other4 120
Origin
Native20 349
Introduced20
Range
Area of Occupancy AOO273 704 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy40% within 1 km
≤100 m 37 313≤1 km 66 652≤10 km 151 230>10 km 2 099
257 294 georeferenced · 56 140 without coordinates
Open the mapobservation + sensor313 434
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 606≤1 km 2 279≤10 km 5 369>10 km 221
8 475 georeferenced · 2 497 without coordinates
Open the institutions mapphysical evidence10 972
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 9
9 georeferenced · 847 without coordinates
Open the mapnot free-living856
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions83 of 166 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 368 |
| Olocation not on record | 408 |
| LDlocation not on record | 346 |
| BIO-UNIPIlocation not on record | 332 |
| Moscow State Universitylocation not on record | 321 |
| Salzburg, AT | 271 |
| Uppsala, SE | 250 |
| South Kensington, GB | 246 |
| MeiseBGlocation not on record | 238 |
| Provincia di Livornolocation not on record | 217 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 183 |
| Bergen, NO | 158 |
| Tartu, EE | 115 |
| Uniwersytet Śląski w Katowicachlocation not on record | 114 |
| BRNUlocation not on record | 107 |
| Oskarshamn, SE | 103 |
| SLU Artdatabankenlocation not on record | 101 |
| Trondheim, NO | 85 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 79 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 73 |
| KMNlocation not on record | 65 |
| Wlocation not on record | 59 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 59 |
| Philadelphia, US | 53 |
| BFLlocation not on record | 45 |
| GJOlocation not on record | 43 |
| Görlitz, DE | 42 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 34 |
| Barcelona, ES | 33 |
| Yerevan, AM | 33 |
| BDBClocation not on record | 31 |
| Vitoria, ES | 30 |
| Bern, CH | 30 |
| Berlin, DE | 29 |
| Frankfurt am Main | 27 |
| DBF-NHMDlocation not on record | 24 |
| BClocation not on record | 24 |
| Dresden, DE | 23 |
| Mlocation not on record | 22 |
| València, ES | 21 |
| Tallinn, EE | 20 |
| Porrentruy, CH | 20 |
| CJBGlocation not on record | 20 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 19 |
| Zürich, CH | 18 |
| Entomological Society of Latvialocation not on record | 17 |
| Christchurch, NZ | 16 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 16 |
| Auckland, NZ | 16 |
| MAlocation not on record | 16 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 13 |
| Oulu, FI | 12 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| Herb. BBGlocation not on record | 10 |
| nbflocation not on record | 10 |
| Bronx, US | 10 |
| Zürich, CH | 9 |
| Tilburg, NL | 9 |
| Stockholm, SE | 8 |
| Kew, GB | 8 |
| Vancouver, CA | 8 |
| Wellington, NZ | 8 |
| Salamanca, ES | 8 |
| Nijmegen, NL | 8 |
| PrivatHerblocation not on record | 8 |
| WTUlocation not on record | 8 |
| Glarus, CH | 7 |
| Tula State Universitylocation not on record | 7 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 7 |
| Natural History Museum Rotterdamlocation not on record | 7 |
| Helsinki, FI | 7 |
| GZUlocation not on record | 7 |
| BSBIlocation not on record | 7 |
| Frauenfeld, CH | 6 |
| Winterthur, CH | 6 |
| SZUlocation not on record | 6 |
| PRClocation not on record | 6 |
| Uniwersytet Opolskilocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| NTNU University Museum, Department of Natural Historylocation not on record | 5 |
| Museo Entomologico de Leonlocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| TROMlocation not on record | 5 |
| Fulda, DE | 4 |
| Bourges, FR | 4 |
| OLAlocation not on record | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Corvallis, US | 4 |
| Whitehorse, CA | 4 |
| Paris, FR | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Pullman, US | 4 |
| Saint Louis, US | 4 |
| Denver, US | 3 |
| Uniwersytet Warszawskilocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Moscow, US | 3 |
| Namur, BE | 3 |
| Salvador, BR | 3 |
| Pamplona, ES | 3 |
| Ann Arbor, US | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Montréal, CA | 3 |
| Podgorica, ME | 3 |
| Xiamen, CN | 2 |
| University of Toronto Mississaugalocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| München, DE | 2 |
| Taipei, TW | 2 |
| McWane Science Centerlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Logan, US | 2 |
| Sion, CH | 2 |
| Davenport, US | 2 |
| Staten Island, US | 2 |
| National Museum Waleslocation not on record | 2 |
| Porvoo, FI | 2 |
| Jackson, US | 2 |
| Portland, US | 2 |
| Durham, US | 2 |
| Toronto, CA | 1 |
| Alicante, ES | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Hobart, AU | 1 |
| Brussel, BE | 1 |
| Philadelphia, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Kensington, AU | 1 |
| H-Wolflocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| San Angelo, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| LfUlocation not on record | 1 |
| Madison, US | 1 |
| CICYTEXlocation not on record | 1 |
| Dekalb, US | 1 |
| Granada, ES | 1 |
| Buenos Aires, AR | 1 |
| Durban, ZA | 1 |
| Finnish Museum of Natural Historylocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Banyoles, ES | 1 |
| Minia, EG | 1 |
| Victoria, CA | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Rotorua, NZ | 1 |
| Plocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| University of Western Ontariolocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Lausanne, CH | 1 |
| San Diego, US | 1 |
| Boise, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
166 institutions · 10 439 of 10 972 vouchered records shown · 422 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Carex sylvatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map6 countries0
in wooded area next to small steamEdges of rich, mesic surgar maple-beech forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.1 °C 7.40–17.2
Seasonal swing summer↔winter15.7 °C
Max temp (day)15.8 °C 8.60–20.9
Min temp (night)9.70 °C 4.70–13.3
Precipitation77.9 mm/mo 62.4–177
Air humidity60.9 % 59.4–64.3
Moisture balance-23.2 mm/mo -52.0–179
Vapour deficit581 Pa 370–775
Wind speed3.90 m/s 2.20–6.80
Cloud cover46.8 % 38.7–54.0
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.