Carex subtilis

K.A.Ford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records118

Data sources6

Biological traits16

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Carex subtilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility118 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources16 traits

Occurrence & distributionGBIF118 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 94

01Narrative

Uncinia elegans is a species of flowering plants in the family Cyperaceae. It is found in New Zealand and Tasmania.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology3

Seed length5 mm

Seed mass1.55 mg

Seed width1.7 mm

Life cycle & reproduction4

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex subtilis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN762539.1 ↗620 bpNew Zealand

ACGT

TTGCGTTGCCCCTCGAAAAACACGACCGTTGCACGCGTGACAGAATGCCGCCGGGGAGGCGCCCGCCGCCTCCCCGGCCCCACGGCCTCT …

Carex subtilis isolate spm00004415 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex subtilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 94 n = 47

Chromosome records94–942n range94median94mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 943×CCDB · new-zealand · CCDB · cyper-only · CCDB · book-ipcn67-71

CCDB · new-zealand

CCDB · cyper-only — Beuzenberg, E. J.1970

CCDB · book-ipcn67-71 — BEUZENBERG, E.J. 1970. Contributions to a chromosome atlas of the New Zealand flora. 14. Uncinia (Cyperaceae). New Zealand J. Bot. 8: 260-263.

08Occurrence & distribution

Record type118 records

Wild obs. + sensor37

Museum / vouchered81

Origin

Native8

Range

Area of Occupancy AOO352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 26≤1 km 3≤10 km 7>10 km 1

37 georeferenced

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 1≤1 km 30≤10 km 1>10 km 2

34 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	29
Christchurch, NZ	26
Wellington, NZ	14
Mount Annan, AU	8
Museo Entomologico de Leonlocation not on record	3
Canberra, AU	1

6 institutions · 81 of 81 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)