Carex subspathacea

Wormsk. ex Hornem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records1 982

Data sources11

Biological traits84

DNA specimens48

eDNA detections27

Sources11 archives

Databases and archives Carex subspathacea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 978 records↗

OBISOcean Biodiversity Information System4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources84 traits

Occurrence & distributionGBIF · OBIS1 982 records

Environmental DNA1 datasets · 5 countries27 detections

DNA & barcodingBOLD · NCBI48 specimens

Genome at a glanceCCDB2n = 78

01Narrative

Осо́ка обёртковидная — вид травянистых растений рода Осока (Carex) семейства Осоковые (Cyperaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.3 m

⚠ sources differ — GIFT: 0.3 m · USDA: 0.305 m · TRY: 0.09 m

Plant height max0.15 m

Plant height min0.03 m

Seed mass0.55 mg

Life cycle & reproduction21

After harvest regrowth rateModerate

Coppice potentialNo

Flower colouryellow

Flower conspicuousNo

Growth rate USDAModerate

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodYes

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seedling vigorHigh

Vegetative spread rateModerate

Diet & foraging1

Parasiteindependent

Habitat & environment22

Adapted to coarse textured soilsNo

Adapted to fine textured soilsNo

Adapted to medium textured soilsNo

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorYellow-Green

Foliage textureFine

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Growth form USDARhizomatous

Habitat GIFTbrackish water, sea, shores

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min12 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry17

Anaerobic toleranceMedium

C:N ratioMedium

Cold stratification requiredNo

Drought toleranceNone

Fertility requirementHigh

Fire resistantNo

Frost free days min120 days

Leaf n32.72 mg/g

Leaf p2.74 mg/g

Nitrogen fixation levelNone

Precipitation max20 in

Precipitation min7 in

Salinity toleranceHigh

Shade toleranceHigh

Soil pH max8.5 pH

Soil pH min4.5 pH

Temperature min-52 °F

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalMedium

Palatable graze animalMedium

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound823 186 per lb

ToxicityNone

Veneer productNo

Other traits5

Fall conspicuousNo

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max20 000 per acre

Planting density min5 120 per acre

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex subspathacea has left across the world's sequence archives.

At a glance

DNA specimens48

Marker genes7

GenBank sequences10

eDNA detections27

Countries5

The DNA barcodea real sequence read deposited for this species

ITSKT960210.1 ↗327 bpGreenland · 2009

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …

Carex subspathacea voucher ZA-PL48 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK★rbcL7★rbcLa★ITS3★ITS1★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex subspathacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 78 n = 39

Chromosome records42–802n range78median78mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 783×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.

CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1978. The cytotaxonomical survey of the monocots of the easternmost Chokchi Peninsula. Bot. Žhurn. (Moscow & Leningrad) 63(8): 1132–1144.

CCDB · book-ipcn75-78 — Yurtsev & Zhukova 1978

2n 422×CCDB · fl-europaea · CCDB · Cave1956

CCDB · fl-europaea — LOve & LOve, 1956

CCDB · Cave1956 — Love & Love b

2n 802×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1980. Chromosome numbers and taxonomy of some species of the Anyui Mts. Bot. Zhurn. 65 (5): 651–659.

CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.

n 391×CCDB · Cave1958

CCDB · Cave1958 — Jorgensen et al. 1958

08Occurrence & distribution

Record type1 982 records

Wild obs. + sensor858

Museum / vouchered1 111

Cultivated / captive4

Other9

Range

Area of Occupancy AOO5 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 232≤1 km 268≤10 km 173>10 km 117

790 georeferenced · 68 without coordinates

Open the mapobservation + sensor858

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 64≤1 km 298≤10 km 268>10 km 32

662 georeferenced · 449 without coordinates

Open the institutions mapphysical evidence1 111

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	200
TROMlocation not on record	183
Trondheim, NO	173
Moscow State Universitylocation not on record	126
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	120
LDlocation not on record	74
Québec, CA	34
Montréal, CA	18
Bergen, NO	16
University of Stellenboschlocation not on record	15
Vancouver, CA	11
Canadian Museum of Naturelocation not on record	7
MAlocation not on record	7
WINlocation not on record	6
WTUlocation not on record	6
Montréal, CA	5
Tromso University Museumlocation not on record	5
Yukon Universitylocation not on record	5
Chongqing Museumlocation not on record	4
University of Winnipeglocation not on record	4
Kew, GB	4
University of Manitoba Herbariumlocation not on record	3
Trois-Rivières, CA	2
Uniwersytet Śląski w Katowicachlocation not on record	2
Stockholm, SE	2
Plocation not on record	2
Logan, US	2
University of Toronto Mississaugalocation not on record	2
Uppsala, SE	2
Research Collection of Siegrun Ertllocation not on record	2
KMNlocation not on record	2
Christchurch, NZ	2
Research Collection of Christian Lettnerlocation not on record	1
University Laval, Herbier Louis-Marielocation not on record	1
Wellington, NZ	1
San Angelo, US	1
Karlsruhe, DE	1
University of Alaska Museumlocation not on record	1
IWEP FEB RASlocation not on record	1
New Haven, US	1
Churchill Northern Studies Centrelocation not on record	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
Oskarshamn, SE	1

43 institutions · 1 057 of 1 111 vouchered records shown · 54 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA27 detections

Where the DNA of Carex subspathacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.50 °C 4.10–11.7

Seasonal swing summer↔winter30.3 °C

Max temp (day)11.9 °C 4.20–16.6

Min temp (night)6.50 °C 1.00–8.60

Precipitation59.7 mm/mo 22.8–98.3

Air humidity61.2 % 55.2–69.5

Moisture balance-7.60 mm/mo

Vapour deficit451 Pa 236–525

Wind speed4.30 m/s

Cloud cover51.2 % 39.0–70.0

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carex subspathacea

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction21

Diet & foraging1

Habitat & environment22

Physiology & chemistry17

Uses & economy14

Other traits5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 982 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 982 records