Carex subdola

Boott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records237

Data sources4

Biological traits25

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Carex subdola's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility237 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF237 records

DNA & barcodingNCBIsequences

01Narrative

Carex subdola adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex subdola sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Boott.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Leaf width4 mm

Leaf width max4 mm

Leaf width min4 mm

Plant height0.34 m

Plant height max0.6 m

Seed length2 mm

Seed length max2 mm

Seed length min2 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeunspecialized

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex subdola has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW398511.1 ↗534 bpNew Zealand · 1994

ACGT

TTGCCTCTCCAGAAACACGACCGTCGAACACGTAACAGAATGCTGCCGCGGAGGCGCTTTCCGCCTCCTTGGCCCCACCGGCTTCTTCCC …

Carex subdola isolate SUBD_NZN2_2E1CBB18 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type237 records

Wild obs. + sensor12

Museum / vouchered225

Range

Area of Occupancy AOO704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 10

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 5≤1 km 6≤10 km 5>10 km 1

17 georeferenced · 208 without coordinates

Open the institutions mapphysical evidence225

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	78
Auckland, NZ	76
Wellington, NZ	58
Rotorua, NZ	9
Palmerston North, NZ	2
Hobart, AU	1
Chicago, US	1

7 institutions · 225 of 225 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)