Carex stricta
Lam. · speciesAt a glance
Occurrence records5 548
Data sources9
Biological traits103
DNA specimens8
eDNA detections7
Sources9 archives
Databases and archives Carex stricta's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 548 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics8 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources103 traits
Occurrence & distributionGBIF5 548 records
Environmental DNA1 datasets · 2 countries7 detections
DNA & barcodingBOLD · NCBI8 specimens
01Narrative
Carex stricta est une espèce de plantes du genre Carex et de la famille des Cyperaceae. Elle est originaire d'Amérique du Nord. Synonyme - Carex strictior Dewey ex Alph.Wood
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology5
Leaf size779 mm²
Plant height1.3 m
⚠ sources differ — GIFT: 1.3 m · USDA: 1.28 m · TRY: 0.553 m
Seed mass0.484 mg
Seed mass max0.529 mg
Seed mass min0.4 mg
Life cycle & reproduction27
After harvest regrowth rateSlow
Bloom periodSpring
Coppice potentialNo
Flower colourgreen
Flower conspicuousNo
Flowering endApr
Flowering startMar
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifeform raunkiaer detailedgeophyte
Lifespan categoryLong
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityNo
Seed spread rateSlow
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 250 m
Elevation min2 900 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colouryellow
Growth formherb
Growth form USDABunch
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typenon-ectomycorrhizal
Root depth min18 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min110 days
Leaf C:N ratio25.9 g/g
Leaf c444 mg/g
Leaf dry-matter content (LDMC)326 mg/g
Leaf n17.24 mg/g
Leaf p1.18 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max65 in
Precipitation min32 in
Salinity toleranceNone
Shade toleranceLow
Soil pH max7 pH
Soil pH min3.5 pH
Specific leaf area (SLA)25.7 mm²/mg
Temperature min-38 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min3 450 per acre
05DNA & barcoding8 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex stricta has left across the world's sequence archives.
At a glance
DNA specimens8
Marker genes5
GenBank sequences10
eDNA detections7
Countries2
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Carex stricta voucher B0691 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS2
plant barcodefungal barcode
08Occurrence & distribution
Record type5 548 records
Wild obs. + sensor2 127
Museum / vouchered3 420
Cultivated / captive1
Origin
Native24
Range
Area of Occupancy AOO13 780 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy85% within 1 km
≤100 m 739≤1 km 115≤10 km 21>10 km 132
1 007 georeferenced · 1 120 without coordinates
Open the mapobservation + sensor2 127
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 164≤1 km 666≤10 km 1 055>10 km 182
2 067 georeferenced · 1 353 without coordinates
Open the institutions mapphysical evidence3 420
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions75 of 118 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Madison, US | 379 |
| Philadelphia, US | 374 |
| St. Paul, US | 266 |
| Chongqing Museumlocation not on record | 185 |
| Chicago, US | 146 |
| Uppsala, SE | 136 |
| Ann Arbor, US | 128 |
| University of New Hampshirelocation not on record | 97 |
| Toronto, CA | 94 |
| Oregon State Universitylocation not on record | 91 |
| Québec, CA | 81 |
| Montréal, CA | 69 |
| Allentown, US | 64 |
| Green Bay, US | 61 |
| Burlington, US | 57 |
| Bloomington, US | 53 |
| Acadia Universitylocation not on record | 51 |
| Bronx, US | 50 |
| Université Lavallocation not on record | 48 |
| University of Stellenboschlocation not on record | 47 |
| International Salmonella Centre (W.H.O.)location not on record | 45 |
| University of Toronto Mississaugalocation not on record | 36 |
| Saint John, CA | 34 |
| DULlocation not on record | 33 |
| College Park, US | 32 |
| Wuzhou, CN | 31 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 30 |
| Saint Louis, US | 30 |
| Tampa, US | 28 |
| New Haven, US | 27 |
| University of Wisconsinlocation not on record | 25 |
| Chicago, US | 24 |
| Williamsburg, US | 21 |
| Whitewater, US | 20 |
| Jackson, US | 20 |
| Dekalb, US | 20 |
| Philadelphia, US | 19 |
| Dover, US | 19 |
| Durham, US | 19 |
| Staten Island, US | 16 |
| Little Rock, US | 14 |
| Mount Pleasant, US | 14 |
| Tuscaloosa, US | 10 |
| Bangkok, TH | 10 |
| Norfolk, US | 10 |
| San Angelo, US | 10 |
| Science Museum of Minnesotalocation not on record | 9 |
| Montréal, CA | 9 |
| Millersville, US | 8 |
| Auckland, NZ | 7 |
| Museum of the Rockieslocation not on record | 6 |
| McWane Science Centerlocation not on record | 6 |
| Christchurch, NZ | 6 |
| Karlsruhe, DE | 6 |
| Weber State Universitylocation not on record | 5 |
| Morgantown, US | 5 |
| Chapel Hill, US | 5 |
| Maryland Department of Natural Resourceslocation not on record | 5 |
| Oswego, US | 5 |
| Hamilton, US | 5 |
| Mohonk Preservelocation not on record | 5 |
| Davenport, US | 4 |
| Trois-Rivières, CA | 4 |
| Hudson, US | 4 |
| University of Wisconsinlocation not on record | 4 |
| Fairfax, US | 4 |
| GAlocation not on record | 3 |
| Vancouver, CA | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| New Brunswick, US | 3 |
| Mississippi State, US | 3 |
| University of Winnipeglocation not on record | 3 |
| Spearfish, US | 3 |
| BAYLUlocation not on record | 3 |
| Delaware State University, Claude E. Phillips Herbariumlocation not on record | 2 |
| Keene State Universitylocation not on record | 2 |
| Black Rock Forest Consortiumlocation not on record | 2 |
| Claremont, US | 2 |
| WINlocation not on record | 2 |
| Chicago, US | 2 |
| Boise, US | 2 |
| Denver, US | 2 |
| Waverly, US | 2 |
| Wellington, NZ | 2 |
| Whitehorse, CA | 2 |
| Phoenix, US | 2 |
| Richmond, US | 2 |
| Fort Worth, US | 2 |
| University of Western Ontariolocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Pondicherry, IN | 1 |
| Musée des Confluenceslocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| BClocation not on record | 1 |
| Moscow, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Fayetteville, US | 1 |
| LINUlocation not on record | 1 |
| US | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| EL PASO, US | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Emporia, US | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Austin, US | 1 |
| Kingston, US | 1 |
| Springfield, US | 1 |
| Flagstaff, US | 1 |
| Zürich, CH | 1 |
| Clarksville, US | 1 |
| Ypsilanti, US | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
118 institutions · 3 270 of 3 420 vouchered records shown · 148 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA7 detections
Where the DNA of Carex stricta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.2 °C 18.4–20.1
Seasonal swing summer↔winter23.1 °C
Max temp (day)24.8 °C 23.0–25.0
Min temp (night)14.4 °C 13.6–16.4
Precipitation87.0 mm/mo 83.9–135
Air humidity57.7 % 57.4–61.2
Moisture balance-48.1 mm/mo -77.9–-20.3
Vapour deficit945 Pa 820–999
Wind speed4.60 m/s 3.90–4.80
Cloud cover37.5 % 35.9–40.3
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.