Carex straminea

Willd. ex Schkuhr · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records239

Data sources9

Biological traits93

DNA specimens9

eDNA detections9

Sources9 archives

Databases and archives Carex straminea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources93 traits

Occurrence & distributionGBIF239 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT349 Mbp

01Narrative

Carex straminea adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex straminea sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Willd. ex Schkuhr.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology3

Plant height0.91 m

⚠ sources differ — GIFT: 0.91 m · USDA: 0.914 m · TRY: 0.32 m

Plant height generative0.27 m

Seed mass0.564 mg

Life cycle & reproduction25

After harvest regrowth rateSlow

Bloom periodLate Spring

Coppice potentialNo

Flower colourgreen

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDAModerate

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Lifespan categoryModerate

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsYes

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsNo

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Growth form USDABunch

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min8 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry20

Anaerobic toleranceHigh

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceLow

Fertility requirementMedium

Fire resistantNo

Fire toleranceHigh

Frost free days min95 days

Leaf dry-matter content (LDMC)257 mg/g

Moisture useHigh

Nitrogen fixation levelNone

Precipitation max55 in

Precipitation min36 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceLow

Soil pH max6.9 pH

Soil pH min4.7 pH

Temperature min-28 °F

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max4 800 per acre

Planting density min2 700 per acre

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex straminea has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences8

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN762786.1 ↗605 bpUSA

ACGT

TTGCCTCTCGAAAACACGACCGTTGCACATGTGACAGAATGCTGTCGGGGAGGTGCTTGTTGCCTCCTCGGCCCCACCGGCCTCGTCCCT …

Carex straminea isolate spm00002682 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Carex straminea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size348 657 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Carex straminea0.35 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 74 n = 37

Chromosome records74–742n range74median74mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 742×GoaT · Kew Plant DNA C-values Database · CCDB · carex

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · carex — Rothrock and Reznicek 1996; Wahl 1940

n 371×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Rothrock, P. E. & A. A. Reznicek. 1996. Documented chromosome numbers 1996: 1. Chromosome numbers in Carex section Ovales (Cyperaceae) from eastern North America. Sida 17(1): 251–258.

08Occurrence & distribution

Record type239 records

Wild obs. + sensor11

Museum / vouchered228

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1≤1 km 1>10 km 6

8 georeferenced · 3 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 5≤1 km 13≤10 km 90>10 km 15

123 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence228

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	42
Saint Louis, US	20
Chicago, US	18
New Haven, US	14
McWane Science Centerlocation not on record	12
Madison, US	11
Tampa, US	8
Auckland, NZ	8
University of Stellenboschlocation not on record	7
Bloomington, US	6
University of New Hampshirelocation not on record	4
Wuzhou, CN	3
Saint John, CA	2
Longwood Universitylocation not on record	2
Jurica-Suchy Nature Museumlocation not on record	1
WTUlocation not on record	1
Claremont, US	1
Delaware State University, Claude E. Phillips Herbariumlocation not on record	1
Toronto, CA	1
Uppsala, SE	1
Science Museum of Minnesotalocation not on record	1

21 institutions · 164 of 228 vouchered records shown · 64 without an institution code

09Environmental DNA9 detections

Where the DNA of Carex straminea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter24.2 °C

Max temp (day)22.1 °C

Min temp (night)11.8 °C

Precipitation113 mm/mo

Air humidity57.0 %

Moisture balance-28.7 mm/mo

Vapour deficit832 Pa

Wind speed3.70 m/s

Cloud cover44.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)