Carex stipata
Muhl. ex Willd. · speciesAt a glance
Occurrence records6 726
Data sources11
Biological traits101
DNA specimens35
eDNA detections34
Sources11 archives
Databases and archives Carex stipata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 710 records↗
OBISOcean Biodiversity Information System16 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics35 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources101 traits
Occurrence & distributionGBIF · OBIS6 726 records
Environmental DNA1 datasets · 3 countries34 detections
DNA & barcodingBOLD · NCBI35 specimens
Genome at a glanceCCDB · GoaT380 Mbp
01Narrative
Осо́ка стеснённая — многолетнее травянистое растение, вид рода Осока (Carex) семейства Осоковые (Cyperaceae).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology6
Plant height1.1 m
⚠ sources differ — GIFT: 1.1 m · USDA: 1.07 m · TRY: 1.03 m
Plant height max0.8 m
Plant height min0.5 m
Seed mass0.739 mg
Seed mass max0.74 mg
Seed mass min0.738 mg
Life cycle & reproduction26
After harvest regrowth rateSlow
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessn.d.
Flower colourgreen
Flower conspicuousNo
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDASlow
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifeform raunkiaer detailedgeophyte
Lifespan categoryModerate
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Growth formherb
Growth form USDABunch
Habitat GIFTmeadows: wet
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.00000669
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry22
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min80 days
Leaf dry-matter content (LDMC)153 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min12 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceLow
Soil pH max7.9 pH
Soil pH min4.9 pH
Specific leaf area (SLA)12.75 mm²/mg
Temperature min-38 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min2 700 per acre
05DNA & barcoding35 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex stipata has left across the world's sequence archives.
At a glance
DNA specimens35
Marker genes7
GenBank sequences10
eDNA detections34
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Carex stipata voucher 68736HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS2atpF-atpHtrnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Carex stipata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size379 953 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex stipata0.38 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 52 n = 26
Chromosome records52–522n range52median52mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 523×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · carex
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
CCDB · carex — Love, A. & D. Love 1981, cited in Hipp 2007; Whitkus, R. 1981
n 261×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Whitkus, R. 1981. Chromosome numbers of some northern New Jersey carices. Rhodora 83: 46 1 –464.
08Occurrence & distribution
Record type6 726 records
Wild obs. + sensor2 187
Museum / vouchered4 527
Cultivated / captive12
Origin
Native19
Range
Area of Occupancy AOO20 524 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 1 208≤1 km 190≤10 km 53>10 km 233
1 684 georeferenced · 503 without coordinates
Open the mapobservation + sensor2 187
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 170≤1 km 568≤10 km 972>10 km 103
1 813 georeferenced · 2 714 without coordinates
Open the institutions mapphysical evidence4 527
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 12 records without
Open the mapnot free-living12
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions128 of 200 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Philadelphia, US | 384 |
| Bronx, US | 331 |
| Chongqing Museumlocation not on record | 238 |
| Québec, CA | 201 |
| Chicago, US | 163 |
| Madison, US | 157 |
| Ann Arbor, US | 141 |
| Nagano City, JP | 119 |
| Toronto, CA | 111 |
| Jackson, US | 97 |
| Shinshu Universitylocation not on record | 94 |
| Acadia Universitylocation not on record | 81 |
| Odawara, JP | 75 |
| International Salmonella Centre (W.H.O.)location not on record | 72 |
| Université Lavallocation not on record | 70 |
| Green Bay, US | 65 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 64 |
| Saint Louis, US | 61 |
| University of Wisconsinlocation not on record | 59 |
| Tampa, US | 57 |
| Vancouver, CA | 57 |
| Corvallis, US | 53 |
| Allentown, US | 50 |
| Missoula, US | 48 |
| Saint John, CA | 46 |
| Flagstaff, US | 45 |
| Dover, US | 44 |
| Moscow, US | 43 |
| Denver, US | 40 |
| University of Stellenboschlocation not on record | 39 |
| ASUlocation not on record | 38 |
| Lincoln, US | 38 |
| WINlocation not on record | 35 |
| Wuzhou, CN | 35 |
| Victoria, CA | 35 |
| Bangkok, TH | 33 |
| University of Alberta Museumslocation not on record | 30 |
| Tsukuba, JP | 30 |
| Montréal, CA | 29 |
| New Haven, US | 29 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 29 |
| Chadron, US | 28 |
| Jena Microbial Resource Collectionlocation not on record | 27 |
| Tomioka, JP | 24 |
| Toyama, JP | 23 |
| Kushiro City Museumlocation not on record | 22 |
| Albuquerque, US | 21 |
| Oregon State Universitylocation not on record | 21 |
| San Angelo, US | 20 |
| Fukushima Universitylocation not on record | 20 |
| Bozeman, US | 20 |
| KIRMlocation not on record | 20 |
| Williamsburg, US | 19 |
| SIHUlocation not on record | 18 |
| Otaru, JP | 18 |
| College Park, US | 18 |
| University of Toronto Mississaugalocation not on record | 17 |
| St. Paul, US | 16 |
| McWane Science Centerlocation not on record | 16 |
| Akita Prefectural Museumlocation not on record | 16 |
| Chicago, US | 16 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 16 |
| Dekalb, US | 14 |
| Phoenix, US | 13 |
| Obihiro Centennial City Museumlocation not on record | 12 |
| Portland, US | 12 |
| Staten Island, US | 12 |
| Montréal, CA | 12 |
| Keene State Universitylocation not on record | 11 |
| Davenport, US | 11 |
| Christchurch, NZ | 10 |
| Auckland, NZ | 10 |
| Tacoma, US | 10 |
| Boise, US | 10 |
| Museum of the Rockieslocation not on record | 9 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 8 |
| Provo, US | 8 |
| Chiba, JP | 8 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 8 |
| Whitewater, US | 8 |
| Ypsilanti, US | 8 |
| Royal Botanical Gardenslocation not on record | 8 |
| Columbia, US | 8 |
| Logan, US | 7 |
| Iwate Prefectural Museumlocation not on record | 7 |
| Claremont, US | 7 |
| Chapel Hill, US | 7 |
| Northeastern Forestry Universitylocation not on record | 7 |
| Pullman, US | 7 |
| Spearfish, US | 7 |
| Sanda, JP | 7 |
| Richmond, US | 7 |
| JP | 6 |
| Burlington, US | 6 |
| Cheney, US | 6 |
| DULlocation not on record | 6 |
| Tuscaloosa, US | 6 |
| Paris, FR | 6 |
| Mississippi State, US | 5 |
| EL PASO, US | 5 |
| Millersville, US | 5 |
| Mount Pleasant, US | 5 |
| Caldwell, US | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Hokkaido University Botanic Gardenlocation not on record | 5 |
| Sendai, JP | 5 |
| Nishihara, JP | 5 |
| Karlsruhe, DE | 4 |
| BAYLUlocation not on record | 4 |
| Delaware State University, Claude E. Phillips Herbariumlocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Moscow State Universitylocation not on record | 4 |
| Norfolk, US | 4 |
| Kiritappu Wetland National Trustlocation not on record | 4 |
| Pocatello, US | 4 |
| Riverside, US | 4 |
| Miami, US | 3 |
| Anchorage, US | 3 |
| SEFlocation not on record | 3 |
| Sapporo, JP | 3 |
| Wellington, NZ | 3 |
| Oswego, US | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| State University of New York, College at Oneontalocation not on record | 3 |
| GAlocation not on record | 3 |
| Bloomington, US | 3 |
| Taipei, TW | 3 |
| Johnson City, US | 3 |
| Bend, US | 3 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Knoxville, US | 3 |
| USFS/BHSClocation not on record | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| University of Western Ontariolocation not on record | 2 |
| Chicago, US | 2 |
| Austin, US | 2 |
| CASlocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| New Brunswick, US | 2 |
| Bando, JP | 2 |
| Black Rock Forest Consortiumlocation not on record | 2 |
| Wuhan, CN | 2 |
| Hokkaido University Museumlocation not on record | 2 |
| Hamilton, US | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| University of Winnipeglocation not on record | 2 |
| Fargo, US | 2 |
| Decorah, US | 2 |
| Bothell, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Lubbock, US | 2 |
| University of Southern Mississippilocation not on record | 2 |
| San Luis Obispo, US | 2 |
| Kochi, JP | 1 |
| Santa Barbara, US | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Washington, US | 1 |
| Asheville, US | 1 |
| Porto Alegre, BR | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| San Diego, US | 1 |
| Pondicherry, IN | 1 |
| Smithsonian Institutionlocation not on record | 1 |
| Bourges, FR | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Durham, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Xining, CN | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Due West, US | 1 |
| Beijing, CN | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| LINUlocation not on record | 1 |
| Uppsala, SE | 1 |
| Kirksville, US | 1 |
| Pittsburg, US | 1 |
| Cambridge, US | 1 |
| Hangzhou, CN | 1 |
| KR | 1 |
| Morgantown, US | 1 |
| GB | 1 |
| AUAlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Fort Worth, US | 1 |
| Durango, US | 1 |
| Trois-Rivières, CA | 1 |
| Durham, US | 1 |
| Kew, GB | 1 |
| University of New Hampshirelocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Kingston, US | 1 |
| Emporia, US | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Taipei, TW | 1 |
200 institutions · 4 411 of 4 527 vouchered records shown · 113 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA34 detections
Where the DNA of Carex stipata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found34
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 34 detections have coordinates
Open the map3 countries0
Managed boreal mixedwood stand
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.9 °C 12.5–18.8
Seasonal swing summer↔winter27.4 °C
Max temp (day)21.3 °C 16.2–24.1
Min temp (night)11.6 °C 7.40–15.5
Precipitation102 mm/mo 71.6–113
Air humidity58.1 % 55.4–62.3
Moisture balance-38.2 mm/mo -68.7–28.3
Vapour deficit759 Pa 597–914
Wind speed3.30 m/s 2.00–5.50
Cloud cover41.1 % 36.6–49.3
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.