Carex stenostachys

Franch. & Sav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records98

Data sources5

Biological traits9

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Carex stenostachys's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility98 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF98 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 58

01Narrative

Carex stenostachys adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex stenostachys sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Franch. & Sav..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex stenostachys has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN762248.1 ↗623 bpJapan

ACGT

TTGCCGTTGCCTTTCCAAAACACGACCGTCGAACATGTGACAGAATGCTGCCGTGGAGGCGCTTGCCGCCTCCTCGGCCCCACCGGCCTC …

Carex stenostachys isolate spm00006689 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex stenostachys carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 58 n = 29

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 581×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hoshino, T. 1981a. Karyomorphological and cytogenetical studies on aneuploidy in Carex. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 2, 17: 155–238.

n 291×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hoshino, T. 1981a. Karyomorphological and cytogenetical studies on aneuploidy in Carex. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 2, 17: 155–238.

08Occurrence & distribution

Record type98 records

Wild obs. + sensor2

Museum / vouchered96

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KURAlocation not on record	44
Ishikawa Museum of Natural Historylocation not on record	17
Taipei, TW	11
Chiba, JP	5
KOMlocation not on record	4
Fukushima Universitylocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	3
IPA/SPlocation not on record	2
UFPElocation not on record	1
Sagamihara, JP	1
Beijing, CN	1
University of Stellenboschlocation not on record	1
Sanda, JP	1
Kochi, JP	1
Burlington, US	1

15 institutions · 96 of 96 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)