Carex spissa

L.H.Bailey ex Hemsl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records333

Data sources8

Biological traits11

DNA specimens5

eDNA detections4

Sources8 archives

Databases and archives Carex spissa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility333 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF333 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

کارکس اسپیسا نام یک گونه از سرده جگن است.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass1.01 mg

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex spissa has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF285040.1 ↗615 bp

ACGT

TCGTTGCCCTTCCAAACACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCCTGTCGCCTCCTCGGCCCCACCGGCCTCCT …

Carex spissa internal transcribed spacer 1, complete sequence; 5.8S ribosomal RNA and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type333 records

Wild obs. + sensor176

Museum / vouchered155

Other2

Origin

Native27

Range

Area of Occupancy AOO804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 112≤1 km 6≤10 km 2>10 km 2

122 georeferenced · 54 without coordinates

Open the mapobservation + sensor176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 40≤1 km 25≤10 km 11>10 km 2

78 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	38
Claremont, US	28
San Luis Obispo, US	15
La Paz, MX	14
ASUlocation not on record	11
San Diego, US	10
Santa Barbara, US	9
Montréal, CA	4
Severin-McDaniel Insect Collectionlocation not on record	4
Ensenada, MX	4
Long Beach, US	3
Mexico City, MX	3
Calabar, NG	2
Durango, MX	2
Pomona Collegelocation not on record	2
Canadian Department of Agriculturelocation not on record	1
Hermosillo, MX	1
Flagstaff, US	1
Wuzhou, CN	1
San Diego Natural History Museum, Herbariumlocation not on record	1
CASlocation not on record	1

21 institutions · 155 of 155 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Carex spissa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 19.9–19.9

Seasonal swing summer↔winter14.8 °C

Max temp (day)28.2 °C

Min temp (night)13.0 °C

Precipitation2.90 mm/mo

Air humidity49.2 %

Moisture balance-181 mm/mo

Vapour deficit1,190 Pa

Wind speed2.90 m/s

Cloud cover16.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)