Carex spicata
Huds. · speciesAt a glance
Occurrence records103 880
Data sources9
Biological traits46
DNA specimens56
eDNA detections29
Sources9 archives
Databases and archives Carex spicata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility103 880 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics56 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources46 traits
Occurrence & distributionGBIF103 880 records
Environmental DNA1 datasets · 8 countries29 detections
DNA & barcodingBOLD · NCBI56 specimens
Genome at a glanceCCDB · GoaT · NCBI450 Mbp
01Narrative
L'espèce Carex spicata Huds. est une plante des prairies, lisières de bois feuillus, bords de chemins.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology16
Leaf mass13.34 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 301 mm² · GIFT: 324 mm²
Leaf width3 mm
Leaf width max3 mm
Leaf width min3 mm
Plant height0.275 m
⚠ sources differ — GIFT: 0.275 m · LEDA: 0.275 m · TRY: 0.573 m
Plant height generative0.4 m
Plant height max0.8 m
Plant height min0.2 m
Seed length2.2 mm
Seed mass2.23 mg
⚠ sources differ — TRY: 2.23 mg · LEDA: 2.5 mg · GIFT: 2.25 mg
Seed mass max2.04 mg
Seed mass min2.03 mg
Seed volume1.9 mm³
Seed volume max1.9 mm³
Seed volume min1.9 mm³
Life cycle & reproduction13
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJun
Flowering startMay
Life formperennial or rhizomatous geophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number27 900
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTLowland
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)275 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)17.19 mm²/mg
⚠ sources differ — TRY: 17.19 mm²/mg · LEDA: 20.26 mm²/mg · GIFT: 20.64 mm²/mg
Other traits1
Diaspore typegenerative dispersule
05DNA & barcoding56 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex spicata has left across the world's sequence archives.
At a glance
DNA specimens56
Marker genes7
GenBank sequences10
eDNA detections29
Countries10
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATTCACGC …
Carex spicata subsp. andresii voucher PLT.0313B 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL★rbcLa★trnL-F★ITS6★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Carex spicata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size449 880 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex spicata0.45 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 58 n = 29
Chromosome records52–602n range58median58mode21records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5816×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +6
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4327
CCDB · fl-europaea — Dietrich, 1972
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Hartvig, P. 1986. Chromosome numbers in Nordic populations of the Carex muricata group (Cyperaceae). Symb. Bot. Upsal. 27: 127–138.
CCDB · ipcn-api-dl — Stoeva, M. P. 1992. Chromosome numbers of Bulgarian Cyperaceae. Fitologija 43: 77–78.
CCDB · ipcn-api-dl — Stoeva, M. & E. Popova. 1997. A taxonomic study of Carex sect. Phaestoglochin and sect. Stellulatae (Cyperaceae) in Bulgaria. Bocconea 5: 787–796.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · kew — Lipnerová I, Bureš P, Horová L, Šmarda P. 2012. Evolution of genome size in Carex (Cyperaceae) in relation to chromosome number and genomic base composition. Annals of Botany.
CCDB · CromoCat 2015 — Stoeva, M. & E. Popova. (1997). A taxonomic study of Carex sect. Phaestoglochin and sect. Stellulatae (Cyperaceae) in Bulgaria. Bocconea 5: 787-796
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 583-587.
CCDB · CromoCat 2015 — Stoeva, M. P. (1992b). Chromosome numbers of Bulgarian Cyperacea. Fitologija 43: 77-78.
2n 604×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · fl-europaea — Druskevic, ined.
CCDB · ipcn-api-dl — Druskevi;aac. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index. Cambridge Univ. Press. Pp. 353–358.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
2n 521×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — HESS, H.E.' E. LANDOLT, & R. HIRZEL. 1967. Flora der Schweiz und angrenzender Gebiete. Band I: Pteridophyte bis Caryophyllaceae. Birkhausen Verlag, Basel & Stuttgart. 858 pp.
n 292×CCDB · ipcn-api-dl · CCDB · book-ipcn72
CCDB · ipcn-api-dl — Hartvig, P. 1986. Chromosome numbers in Nordic populations of the Carex muricata group (Cyperaceae). Symb. Bot. Upsal. 27: 127–138.
CCDB · book-ipcn72 — DIETRICH, w. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type103 880 records
Wild obs. + sensor95 614
Museum / vouchered7 934
Cultivated / captive91
Other241
Origin
Native6 671
Introduced11
Range
Area of Occupancy AOO186 576 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy36% within 1 km
≤100 m 17 177≤1 km 12 173≤10 km 51 290>10 km 399
81 039 georeferenced · 14 575 without coordinates
Open the mapobservation + sensor95 614
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 1 797≤1 km 1 137≤10 km 1 639>10 km 842
5 415 georeferenced · 2 519 without coordinates
Open the institutions mapphysical evidence7 934
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 91 records without
Open the mapnot free-living91
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions85 of 168 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 724 |
| Helsinki, FI | 676 |
| SLU Artdatabankenlocation not on record | 667 |
| Olocation not on record | 537 |
| LDlocation not on record | 518 |
| DBF-NHMDlocation not on record | 453 |
| Tartu, EE | 306 |
| South Kensington, GB | 244 |
| Oskarshamn, SE | 189 |
| KMNlocation not on record | 169 |
| MeiseBGlocation not on record | 160 |
| Uniwersytet Śląski w Katowicachlocation not on record | 150 |
| Turku, FI | 148 |
| Provincia di Livornolocation not on record | 140 |
| BFLlocation not on record | 103 |
| Salzburg, AT | 97 |
| Görlitz, DE | 90 |
| Berlin, DE | 87 |
| BRNUlocation not on record | 83 |
| Oulu, FI | 79 |
| Wlocation not on record | 76 |
| Yerevan, AM | 69 |
| Trondheim, NO | 67 |
| Zürich, CH | 60 |
| Tallinn, EE | 59 |
| Uniwersytet Warszawskilocation not on record | 59 |
| Adam Mickiewicz University in Poznańlocation not on record | 50 |
| Mlocation not on record | 47 |
| Philadelphia, US | 47 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 46 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 42 |
| Bronx, US | 42 |
| GJOlocation not on record | 41 |
| Bergen, NO | 39 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 36 |
| Kuopio, FI | 31 |
| MAlocation not on record | 29 |
| TUR-Alocation not on record | 28 |
| Bern, CH | 26 |
| Zürich, CH | 25 |
| Uppsala, SE | 24 |
| PrivatHerblocation not on record | 24 |
| Frankfurt am Main | 23 |
| Toronto, CA | 22 |
| Allentown, US | 21 |
| Philadelphia, US | 21 |
| BSBIlocation not on record | 20 |
| Chongqing Museumlocation not on record | 19 |
| Nijmegen, NL | 17 |
| H-Adlerlocation not on record | 16 |
| Chicago, US | 15 |
| Porrentruy, CH | 15 |
| University of New Hampshirelocation not on record | 14 |
| CJBGlocation not on record | 14 |
| SZUlocation not on record | 14 |
| Ann Arbor, US | 14 |
| Barcelona, ES | 14 |
| Christchurch, NZ | 12 |
| University of Toronto Mississaugalocation not on record | 12 |
| Acadia Universitylocation not on record | 12 |
| Madison, US | 11 |
| Lausanne, CH | 11 |
| Stockholm, SE | 10 |
| Podgorica, ME | 10 |
| Tilburg, NL | 10 |
| Fulda, DE | 9 |
| Porvoo, FI | 9 |
| TROMlocation not on record | 9 |
| Montréal, CA | 8 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Forssa, FI | 7 |
| NMBU:MINAlocation not on record | 7 |
| València, ES | 7 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 7 |
| Tampa, US | 7 |
| PRClocation not on record | 6 |
| BClocation not on record | 6 |
| San Angelo, US | 6 |
| Madrid, ES | 6 |
| Brussel, BE | 6 |
| GZUlocation not on record | 5 |
| Royal Botanical Gardenslocation not on record | 5 |
| Jyväskylä, FI | 5 |
| Auckland, NZ | 5 |
| NTNU University Museum, Department of Natural Historylocation not on record | 4 |
| Salamanca, ES | 4 |
| Vitoria, ES | 4 |
| National Museum Waleslocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| BG-NMNHSlocation not on record | 4 |
| Oregon State Universitylocation not on record | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Bloomington, US | 3 |
| Kew, GB | 3 |
| CICYTEXlocation not on record | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| UniKSlocation not on record | 3 |
| Logan, US | 3 |
| nbflocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Dover, US | 3 |
| Vancouver, CA | 3 |
| Museum of the Rockieslocation not on record | 2 |
| Sion, CH | 2 |
| H-Meierottlocation not on record | 2 |
| NoColllocation not on record | 2 |
| Whitehorse, CA | 2 |
| Paris, FR | 2 |
| Maryland Department of Natural Resourceslocation not on record | 2 |
| Dresden, DE | 2 |
| Badajoz, ES | 2 |
| H-Hohlalocation not on record | 2 |
| BIO-UNIPIlocation not on record | 2 |
| H-Vollrathlocation not on record | 2 |
| Wellington, NZ | 2 |
| Pullman, US | 2 |
| Durham, US | 2 |
| Philadelphia, US | 2 |
| Moscow State Universitylocation not on record | 2 |
| Saint Louis, US | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| San Sebastián, ES | 2 |
| John May Museum of Natural Historylocation not on record | 1 |
| Williamsburg, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Tromso University Museumlocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Delaware State University, Claude E. Phillips Herbariumlocation not on record | 1 |
| SWlocation not on record | 1 |
| Saint John, CA | 1 |
| New Haven, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Burlington, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Riverside, US | 1 |
| Monastir, TN | 1 |
| Montréal, CA | 1 |
| UoB-IBlocation not on record | 1 |
| Macomb, US | 1 |
| University of California, Riversidelocation not on record | 1 |
| Jackson, US | 1 |
| München, DE | 1 |
| BioFokuslocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| FLADlocation not on record | 1 |
| WTUlocation not on record | 1 |
| Taipei, TW | 1 |
| Xiamen, CN | 1 |
| Beijing, CN | 1 |
| Campo Mourão, BR | 1 |
| Cambridge, US | 1 |
| NMWlocation not on record | 1 |
| Columbia, US | 1 |
| Göteborg, SE | 1 |
| Minia, EG | 1 |
| H-AkrKGlocation not on record | 1 |
| H-Dueringlocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Corvallis, US | 1 |
168 institutions · 7 227 of 7 934 vouchered records shown · 643 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA29 detections
Where the DNA of Carex spicata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map8 countries0
Grassy pathchalk meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 11.4–18.9
Seasonal swing summer↔winter17.7 °C
Max temp (day)19.2 °C 13.4–23.5
Min temp (night)11.1 °C 7.70–14.1
Precipitation79.3 mm/mo 42.1–109
Air humidity60.7 % 56.0–65.1
Moisture balance-35.5 mm/mo
Vapour deficit695 Pa 470–935
Wind speed3.80 m/s
Cloud cover44.8 % 35.6–51.5
CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.