Carex solandri

Boott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records602

Data sources7

Biological traits28

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Carex solandri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility602 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF602 records

DNA & barcodingNCBIsequences

01Narrative

Carex solandri is a species of sedge that was first described by Francis Boott in 1853. It is endemic to both the North and South Islands of New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Leaf width6 mm

Leaf width max6 mm

Leaf width min6 mm

Plant height0.45 m

Plant height max0.8 m

Seed length1 mm

Seed length max1 mm

Seed length min1 mm

Seed mass1.06 mg

Seed mass max1.06 mg

Seed mass min1.06 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeunspecialized

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTCoastal

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex solandri has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU331116.1 ↗769 bpNew Zealand

ACGT

GGCGGTTCGCCGCCTGTGACGTCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Carex solandri voucher AK288218 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type602 records

Wild obs. + sensor107

Museum / vouchered494

Cultivated / captive1

Range

Area of Occupancy AOO1 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 68≤1 km 17≤10 km 3>10 km 5

93 georeferenced · 14 without coordinates

Open the mapobservation + sensor107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 11≤1 km 9≤10 km 3>10 km 2

25 georeferenced · 469 without coordinates

Open the institutions mapphysical evidence494

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	254
Auckland, NZ	127
Wellington, NZ	77
Rotorua, NZ	23
Palmerston North, NZ	4
Canberra, AU	3
Hobart, AU	2
Museo Entomologico de Leonlocation not on record	2
Moscow State Universitylocation not on record	1
Edinburgh, GB	1

10 institutions · 494 of 494 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)