Carex silicea

Olney · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records560

Data sources10

Biological traits11

DNA specimens10

eDNA detections7

Sources10 archives

Databases and archives Carex silicea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility560 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF560 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 74

01Narrative

Carex silicea, known as beach sedge, is a species of sedge native to North America. It is found in the northeastern United States and southeastern Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass0.546 mg

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex silicea has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG216372.1 ↗348 bpUSA · 1993

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …

Carex silicea voucher B0625 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL3★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex silicea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 74 n = 37

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 371×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Rothrock, P. E. & A. A. Reznicek. 1996. Documented chromosome numbers 1996: 1. Chromosome numbers in Carex section Ovales (Cyperaceae) from eastern North America. Sida 17(1): 251–258.

08Occurrence & distribution

Record type560 records

Wild obs. + sensor151

Museum / vouchered409

Range

Area of Occupancy AOO1 552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 84≤1 km 8≤10 km 2>10 km 14

108 georeferenced · 43 without coordinates

Open the mapobservation + sensor151

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 2≤1 km 26≤10 km 133>10 km 38

199 georeferenced · 210 without coordinates

Open the institutions mapphysical evidence409

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	65
Acadia Universitylocation not on record	40
Chicago, US	36
University of New Hampshirelocation not on record	29
Montréal, CA	29
Burlington, US	21
New Haven, US	18
Saint John, CA	17
Ann Arbor, US	11
Durham, US	10
Université Lavallocation not on record	9
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
Wuzhou, CN	6
Tampa, US	6
Bloomington, US	6
Chongqing Museumlocation not on record	6
University of Stellenboschlocation not on record	4
Québec, CA	4
Staten Island, US	3
Oregon State Universitylocation not on record	3
Mississippi State, US	3
Riverside, US	2
Madison, US	2
Bangkok, TH	2
Museum of the Rockieslocation not on record	2
Auckland, NZ	2
Kingston, US	1
Saint Louis, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Claremont, US	1
Keene State Universitylocation not on record	1
Denver, US	1
Honolulu, US	1
Toronto, CA	1
Taipei, TW	1
Paris, FR	1
University of Toronto Mississaugalocation not on record	1
Dover, US	1
Santa Barbara, US	1
Delaware State University, Claude E. Phillips Herbariumlocation not on record	1
Montréal, CA	1
MAlocation not on record	1
Longwood Universitylocation not on record	1
Kew, GB	1
McWane Science Centerlocation not on record	1

45 institutions · 362 of 409 vouchered records shown · 47 without an institution code

09Environmental DNA7 detections

Where the DNA of Carex silicea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 21.2–21.2

Seasonal swing summer↔winter27.6 °C

Max temp (day)26.0 °C

Min temp (night)17.6 °C

Precipitation102 mm/mo

Air humidity59.4 %

Moisture balance-46.5 mm/mo

Vapour deficit1,028 Pa

Wind speed2.50 m/s

Cloud cover43.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)