Carex sheldonii — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records169

Data sources7

Biological traits10

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Carex sheldonii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility169 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF169 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Carex sheldonii is a species of sedge known by the common name Sheldon's sedge.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex sheldonii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK581541.1 ↗613 bpUSA

ACGT

TCGTTGCCTCTCCGGAAACGCGACCGTCGAACACGTGACAGAACGCTGCCGCGGAGGCGCTCGCCGCCTCCTCGGCCCCACCGGCCTCCT …

Carex sheldonii isolate B1086 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcLaITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type169 records

Wild obs. + sensor10

Museum / vouchered159

Range

Area of Occupancy AOO400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤1 km 3≤10 km 2>10 km 5

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 6≤1 km 37≤10 km 13>10 km 1

57 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	25
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	21
Bronx, US	16
Flagstaff, US	15
WTUlocation not on record	10
Caldwell, US	7
Moscow, US	6
Pullman, US	6
CASlocation not on record	5
Boise, US	4
VALElocation not on record	3
Claremont, US	3
Riverside, US	2
Pocatello, US	2
Henderson, US	2
Provo, US	2
Ann Arbor, US	1
Vancouver, CA	1
Chicago, US	1
Davis, US	1
Logan, US	1
Columbia, US	1
Turku, FI	1
MAlocation not on record	1
San Luis Obispo, US	1
Canadian Department of Agriculturelocation not on record	1
Portland, US	1
Wuzhou, CN	1
Bend, US	1
Phoenix, US	1
San Diego, US	1
Angwin, US	1
Santa Barbara, US	1
Madison, US	1
ASUlocation not on record	1
University of Nevadalocation not on record	1

36 institutions · 149 of 159 vouchered records shown · 10 without an institution code

09Environmental DNA4 detections

Where the DNA of Carex sheldonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.