Carex sempervirens
Vill. · speciesAt a glance
Occurrence records61 985
Data sources9
Biological traits35
DNA specimens11
eDNA detections133
Sources9 archives
Databases and archives Carex sempervirens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility61 985 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI133 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources35 traits
Occurrence & distributionGBIF61 985 records
Environmental DNA2 datasets · 3 countries133 detections
DNA & barcodingBOLD · NCBI11 specimens
Genome at a glanceCCDB · GoaT792 Mbp
01Narrative
Carex sempervirens, ou Laîche toujours verte, est une espèce de plantes du genre des carex et de la famille des cypéracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology12
Leaf size281 mm²
Plant height0.15 m
⚠ sources differ — GIFT: 0.15 m · LEDA: 0.15 m · TRY: 0.141 m
Plant height generative0.237 m
Plant height max0.4 m
Plant height min0.2 m
Seed length4.67 mm
Seed mass0.934 mg
Seed mass max1.04 mg
Seed mass min0.95 mg
Seed volume0.9 mm³
Seed volume max0.9 mm³
Seed volume min0.9 mm³
Life cycle & reproduction5
Deciduousnessn.d.
⚠ sources differ — TRY: n.d. · GIFT: evergreen
Dispersal typeanimal
Life formperennial or rhizomatous geophyte
Life spanperennial
Raunkiær life formhemicryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio21.76 g/g
Leaf c458 mg/g
Leaf dry-matter content (LDMC)393 mg/g
Leaf n17.43 mg/g
Leaf p1.29 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)14.56 mm²/mg
Other traits1
Diaspore typefruit with appendage
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex sempervirens has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes4
GenBank sequences10
eDNA detections133
Countries3
The DNA barcodea real sequence read deposited for this species
ACGACCGTCGAACACGTGACAGAATGCTGCCGCGGGGGCGCTCGCCGCCTCCTCGGCCCCCCACCGACCTCCTCCCTCTCGCCTTCTTGG …
Carex sempervirens voucher SOMF31419 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcLa★trnL-F★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Carex sempervirens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size792 180 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex sempervirens0.79 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 30 n = 15
Chromosome records30–682n range30median30mode41records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3023×CCDB · ita-fl · CCDB · slov-fl · CCDB · iber-fl +4
CCDB · ita-fl — DIETRICH W. - 1967. Die Zytotaxonomie der "Carex" Sektion "Frigidae" in Europa.. Feddes Repert. , 75(12): 1/1/1942.
CCDB · slov-fl — Murín A. & Májovský J., 1983: Karyological study of Slovakian flora IV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 30: 1-16.
CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).
CCDB · iber-fl — Contribution l'tude biosystmatique et cologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique... Lazare, J. J.Lejeunia Nov. Ser.126: 1-46(1988).
CCDB · cyper-only — Kupfer, P.1974
CCDB · cyper-only — Lazare, J.-J.1982
CCDB · ipcn-api-dl — Lazare, J. J. 1982. 2317. Bull. Soc. Neuchateloise Sci. Nat. 105: 39–57.
CCDB · ipcn-api-dl — Lazare, J. J. 1988. Contribution à l'étude biosystématique et écologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique taxonomique, caryologie et biologie de la reproduction. Lejeunia, n.s. 126: 18–22.
CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.
CCDB · CromoCat 2015 — Lazare, J. J. (1988). Contribution à l'étude biosystématique et écologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique... Lejeunia 126: 1-46.
CCDB · CromoCat 2015 — Küpfer, P. (1974). Recherches sur les liens de parenté entre la flore orophile des Alpes et celle des Pyrénées. Boissiera 23: 3- 322.
CCDB · CromoCat 2015 — Dietrich, W. (1967). Die Zytotaxonomie der Carex-Sektion Frigidae in Europa. Fedd. Rep. 75: 1–42.
2n 349×CCDB · iber-fl · CCDB · fl-europaea · CCDB · cyper-only +4
CCDB · iber-fl — Contribution l'tude biosystmatique et cologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique... Lazare, J. J.Lejeunia Nov. Ser.126: 1-46(1988).
CCDB · fl-europaea — Dietrich, 1967
CCDB · cyper-only — 176Dietrich, W.1967
CCDB · cyper-only — 180Lazare, J.-J.1988
CCDB · cyper-only — Lazare, J.-J.1988
CCDB · ipcn-api-dl — Lazare, J. J. 1988. Contribution à l'étude biosystématique et écologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique taxonomique, caryologie et biologie de la reproduction. Lejeunia, n.s. 126: 18–22.
CCDB · book-ipcn67-71 — DIETRICH, w. 1967. Die Zytotaxonomie der Carex-Sektion Frigidae in Europa. Fedd. Rap. 75: 1-42.
CCDB · book-ipcn75-78 — NA
CCDB · CromoCat 2015 — Stoeva, M. P. (1987a). Chromosome numbers of Bulgarian Angiosperms. Fitologija 33: 65-66.
2n 328×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · fl-europaea +3
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — DIETRICH W. - 1967. Die Zytotaxonomie der "Carex" Sektion "Frigidae" in Europa.. Feddes Repert. , 75(12): 1/1/1942.
CCDB · fl-europaea — Dietrich, 1967
CCDB · cyper-only — 180Stoeva, M. P., E. D. Popova & K. G. Uzunova1991
CCDB · cyper-only — Druskovic, L. P.1995
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Stoeva, M. P., E. D. Popova & K. G. Uzunova. 1991. Population variability of Carex sempervirens complex and C. kitabeliana Degen in Bulgaria. Pp. 139--159 in. In Evol. Fl. Pl. Florogen., 2. Bulgarian Academy of Sciences, Sofia.
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
2n 331×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Stoeva, M. P. (1987a). Chromosome numbers of Bulgarian Angiosperms. Fitologija 33: 65-66.
2n 681×CCDB · fl-europaea
CCDB · fl-europaea — Lazare, 1976
n 179×CCDB · iber-fl · CCDB · cyper-only · CCDB · ipcn-api-dl +1
CCDB · iber-fl — Contribution l'tude biosystmatique et cologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique... Lazare, J. J.Lejeunia Nov. Ser.126: 1-46(1988).
CCDB · cyper-only — 177Hindakova, M. & J. Majovsky1976
CCDB · cyper-only — 179Lazare, J.-J.1982
CCDB · cyper-only — 179Lazare, J.-J.1988
CCDB · cyper-only — Lazare, J.-J.1988
CCDB · ipcn-api-dl — Lazare, J. J. 1988. Contribution à l'étude biosystématique et écologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique taxonomique, caryologie et biologie de la reproduction. Lejeunia, n.s. 126: 18–22.
CCDB · book-ipcn75-78 — NA
CCDB · book-ipcn75-78 — Lazare 1976
n 153×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribution l'tude biosystmatique et cologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique... Lazare, J. J.Lejeunia Nov. Ser.126: 1-46(1988).
CCDB · ipcn-api-dl — Lazare, J. J. 1988. Contribution à l'étude biosystématique et écologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique taxonomique, caryologie et biologie de la reproduction. Lejeunia, n.s. 126: 18–22.
CCDB · CromoCat 2015 — Lazare, J. J. (1988). Contribution à l'étude biosystématique et écologique du complexe orophile Carex sempervirens Vill. (Cyperaceae) historique... Lejeunia 126: 1-46.
08Occurrence & distribution
Record type61 985 records
Wild obs. + sensor57 836
Museum / vouchered2 179
Other1 970
Range
Area of Occupancy AOO20 380 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy14% within 1 km
≤100 m 1 069≤1 km 5 783≤10 km 41 992>10 km 408
49 252 georeferenced · 8 584 without coordinates
Open the mapobservation + sensor57 836
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 146≤1 km 337≤10 km 789>10 km 9
1 281 georeferenced · 898 without coordinates
Open the institutions mapphysical evidence2 179
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions43 of 86 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Salzburg, AT | 383 |
| Uniwersytet Wrocławskilocation not on record | 242 |
| BFLlocation not on record | 227 |
| Zürich, CH | 164 |
| Provincia di Livornolocation not on record | 104 |
| Bern, CH | 80 |
| Zürich, CH | 69 |
| GJOlocation not on record | 63 |
| BRNUlocation not on record | 62 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 50 |
| Entomological Society of Latvialocation not on record | 43 |
| Barcelona, ES | 38 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 35 |
| Wlocation not on record | 34 |
| Moscow State Universitylocation not on record | 33 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 33 |
| LDlocation not on record | 31 |
| Glarus, CH | 29 |
| Görlitz, DE | 28 |
| Karlsruhe, DE | 27 |
| Adam Mickiewicz University in Poznańlocation not on record | 23 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 22 |
| San Sebastián, ES | 21 |
| Vitoria, ES | 21 |
| LfUlocation not on record | 20 |
| Mlocation not on record | 17 |
| SZUlocation not on record | 17 |
| Porrentruy, CH | 14 |
| BDBClocation not on record | 13 |
| GZUlocation not on record | 12 |
| BClocation not on record | 11 |
| Frankfurt am Main | 11 |
| PRClocation not on record | 11 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 10 |
| MAlocation not on record | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 9 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 7 |
| Oskarshamn, SE | 7 |
| Pamplona, ES | 6 |
| Sion, CH | 5 |
| CJBGlocation not on record | 5 |
| Paris, FR | 5 |
| València, ES | 5 |
| Salamanca, ES | 5 |
| Wellington, NZ | 5 |
| Museo Achille Folettolocation not on record | 4 |
| Montréal, CA | 4 |
| Berlin, DE | 4 |
| Bourges, FR | 4 |
| CICYTEXlocation not on record | 3 |
| Alicante, ES | 3 |
| Auckland, NZ | 3 |
| Winterthur, CH | 3 |
| Dresden, DE | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Christchurch, NZ | 3 |
| Urumqi, CN | 2 |
| Kew, GB | 2 |
| PrivatHerblocation not on record | 2 |
| Taipei, TW | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Jaén, ES | 1 |
| University of Stellenboschlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Granada, ES | 1 |
| JBAlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Lausanne, CH | 1 |
| Québec, CA | 1 |
| Dhaka, BD | 1 |
| IPE-CSIClocation not on record | 1 |
| Saint Louis, US | 1 |
| H-Adlerlocation not on record | 1 |
| Madrid, ES | 1 |
| Martin-Luther-Universität Halle-Wittenberglocation not on record | 1 |
| No collectionlocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| NoColllocation not on record | 1 |
| Bangkok, TH | 1 |
| Macomb, US | 1 |
| Flagstaff, US | 1 |
| Göteborg, SE | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| Trondheim, NO | 1 |
| Fribourg, CH | 1 |
86 institutions · 2 137 of 2 179 vouchered records shown · 40 without an institution code
09Environmental DNA133 detections
Where the DNA of Carex sempervirens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found133
Studies independent surveys2
Countries3
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 133 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median6.90 °C 6.90–11.5
Seasonal swing summer↔winter18.1 °C
Max temp (day)10.5 °C 10.5–16.0
Min temp (night)1.10 °C 1.10–5.70
Precipitation273 mm/mo 273–294
Air humidity63.5 % 62.1–63.5
Moisture balance164 mm/mo 164–164
Vapour deficit364 Pa 364–515
Wind speed4.00 m/s 3.30–4.00
Cloud cover39.7 % 35.8–39.7
CHELSA 1981–2010, ~9 km grid, at location & month of 131 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.