Carex secalina

Willd. ex Wahlenb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records692

Data sources8

Biological traits28

DNA specimens4

eDNA detections19

Sources8 archives

Databases and archives Carex secalina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility692 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.23 Gbp↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF692 records

Environmental DNA2 datasets · 1 countries19 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaT235 Mbp

01Narrative

Turzyca żytowata – gatunek byliny z rodziny ciborowatych. Występuje od środkowej Europy po środkową Azję. W latach 50. XX wieku gatunek uznany w Polsce za wymarły. W latach 90. odkryty ponownie, występuje tylko na kilku stanowiskach w okolicach Inowrocławia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Plant height0.2 m

⚠ sources differ — GIFT: 0.2 m · LEDA: 0.2 m · TRY: 0.3 m

Plant height generative0.2 m

Plant height max0.4 m

Plant height min0.1 m

Seed mass1.04 mg

⚠ sources differ — TRY: 1.04 mg · LEDA: 1.02 mg · GIFT: 0.978 mg

Life cycle & reproduction10

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typewater

Flowering endJun

Flowering startMay

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max3 200 m

Elevation min1 800 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTopen roadsides

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits2

Diaspore typeone-seeded generative dispersule

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex secalina has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences2

eDNA detections19

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN762940.1 ↗564 bpHungary

ACGT

CGCCTCCCCGGCCCCGCCGGCCTCCTCCCTCCCGCCCTCCGGGGCGCGTCGGTTGCTGGCCGGAACACGGCGCGGGATGACGCCAAGGAA …

Carex secalina isolate spm00004542 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Carex secalina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size234 720 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Carex secalina0.23 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type692 records

Wild obs. + sensor440

Museum / vouchered247

Fossil2

Other3

Range

Area of Occupancy AOO1 696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 122≤1 km 89≤10 km 20>10 km 135

366 georeferenced · 74 without coordinates

Open the mapobservation + sensor440

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 23≤1 km 45≤10 km 44>10 km 21

133 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BRNUlocation not on record	62
Uniwersytet Wrocławskilocation not on record	24
KFGBlocation not on record	18
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	17
Moscow State Universitylocation not on record	16
Provincia di Livornolocation not on record	14
GJOlocation not on record	11
Yerevan, AM	10
Bronx, US	9
Wlocation not on record	8
Frankfurt am Main	3
PRClocation not on record	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
LDlocation not on record	3
Chapel Hill, US	3
Berlin, DE	3
Kostrzyca Forest Gene Banklocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	2
SZUlocation not on record	2
University of Stellenboschlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
MeiseBGlocation not on record	2
Corvallis, US	1
Canadian Department of Agriculturelocation not on record	1
Salzburg, AT	1
Philadelphia, US	1
Oulu, FI	1
Dresden, DE	1
Oskarshamn, SE	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
BClocation not on record	1

31 institutions · 229 of 247 vouchered records shown · 17 without an institution code

09Environmental DNA19 detections

Where the DNA of Carex secalina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–16.4

Seasonal swing summer↔winter19.9 °C

Max temp (day)20.6 °C

Min temp (night)11.8 °C

Precipitation56.9 mm/mo

Air humidity59.0 %

Moisture balance-65.5 mm/mo

Vapour deficit763 Pa

Wind speed3.90 m/s

Cloud cover32.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)