Carex scoparia
Schkuhr ex Willd. · speciesAt a glance
Occurrence records5 340
Data sources10
Biological traits112
DNA specimens46
eDNA detections33
Sources10 archives
Databases and archives Carex scoparia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 340 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics46 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources112 traits
Occurrence & distributionGBIF5 340 records
Environmental DNA1 datasets · 6 countries33 detections
DNA & barcodingBOLD · NCBI46 specimens
Genome at a glanceCCDB · GoaT · NCBI≈298 Mbp
01Narrative
Carex leporina, la Laîche des lièvres, est une espèce de plantes du genre Carex et de la famille des Cyperaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYAusTraitsGIFTUSDA
Size & morphology10
Leaf size272 mm²
Leaf width3 mm
Leaf width max3 mm
Leaf width min3 mm
Plant height0.605 m
⚠ sources differ — GIFT: 0.605 m · USDA: 0.762 m · TRY: 0.336 m
Plant height max0.9 m
Seed length1 mm
Seed length max1 mm
Seed length min1 mm
Seed mass0.437 mg
Life cycle & reproduction31
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeunspecialized
Flower colourgreen
Flower conspicuousNo
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Sex typemonoecious
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typenut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid · TRY: Graminoid
Growth form USDABunch
Habitat GIFTLowland
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry23
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min85 days
Leaf C:N ratio30.53 g/g
Leaf c431 mg/g
Leaf n15.29 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Precipitation max55 in
Precipitation min20 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceLow
Soil pH max6.9 pH
Soil pH min4.6 pH
Specific leaf area (SLA)17.74 mm²/mg
Temperature min-38 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min2 700 per acre
05DNA & barcoding46 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex scoparia has left across the world's sequence archives.
At a glance
DNA specimens46
Marker genes5
GenBank sequences10
eDNA detections33
Countries6
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Carex scoparia voucher B0916 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Carex scoparia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈298 037 631 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex scoparia0.30 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 64 n = 32
Chromosome records56–702n range64median64mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 562×CCDB · carex · CCDB · Automatic manuscript search
CCDB · carex — Tanaka 1942, cited in Whitkus 1991
CCDB · Automatic manuscript search — A. Hipp,P. E. Rothrock,R. Whitkus and J. A. Weber. 2010. "Chromosomes tell half of the story: the correlation between karyotype rearrangements and genetic diversity in sedges, a group with holocentric chromosomes". Molecular Ecology 19:n. pag.
2n 602×CCDB · ipcn-api-dl · CCDB · carex
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
CCDB · carex — Love 1981; Moore and Calder 1964; Hipp 2007
2n 642×CCDB · nw-europe-fl · CCDB · carex
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4340
CCDB · carex — Hipp et al. 2010; Wahl 1940
2n 662×CCDB · carex · CCDB · Automatic manuscript search
CCDB · carex — Hipp et al. 2010
CCDB · Automatic manuscript search — A. Hipp,P. E. Rothrock,R. Whitkus and J. A. Weber. 2010. "Chromosomes tell half of the story: the correlation between karyotype rearrangements and genetic diversity in sedges, a group with holocentric chromosomes". Molecular Ecology 19:n. pag.
2n 682×CCDB · carex · CCDB · kew
CCDB · carex — Moore and Calder 1964; Hipp 2007; Whitkus 1981
CCDB · kew — Lipnerová I, Bureš P, Horová L, Šmarda P. 2012. Evolution of genome size in Carex (Cyperaceae) in relation to chromosome number and genomic base composition. Annals of Botany.
2n 581×CCDB · carex
CCDB · carex — Tanaka 1942, cited in Whitkus 1991; Hipp 2007
2n 591×CCDB · carex
CCDB · carex — Hipp et al. 2010
2n 611×CCDB · carex
CCDB · carex — Hipp et al. 2010
2n 621×CCDB · carex
CCDB · carex — Hipp et al. 2010
2n 671×CCDB · carex
CCDB · carex — Hipp et al. 2010
2n 701×CCDB · carex
CCDB · carex — Hipp et al. 2010
n 341×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
08Occurrence & distribution
Record type5 340 records
Wild obs. + sensor1 064
Museum / vouchered4 274
Cultivated / captive2
Origin
Native16
Introduced3
Range
Area of Occupancy AOO15 064 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 511≤1 km 65≤10 km 51>10 km 100
727 georeferenced · 337 without coordinates
Open the mapobservation + sensor1 064
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 196≤1 km 623≤10 km 1 169>10 km 147
2 135 georeferenced · 2 139 without coordinates
Open the institutions mapphysical evidence4 274
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions110 of 175 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Philadelphia, US | 483 |
| Bronx, US | 384 |
| Chongqing Museumlocation not on record | 377 |
| Chicago, US | 191 |
| Ann Arbor, US | 169 |
| Montréal, CA | 147 |
| University of New Hampshirelocation not on record | 134 |
| Acadia Universitylocation not on record | 120 |
| Oregon State Universitylocation not on record | 105 |
| Québec, CA | 99 |
| Madison, US | 97 |
| Allentown, US | 95 |
| International Salmonella Centre (W.H.O.)location not on record | 94 |
| Saint John, CA | 86 |
| Wuzhou, CN | 85 |
| Burlington, US | 83 |
| University of Stellenboschlocation not on record | 64 |
| Bloomington, US | 62 |
| Lincoln, US | 54 |
| New Haven, US | 54 |
| College Park, US | 51 |
| Toronto, CA | 47 |
| Jackson, US | 46 |
| Flagstaff, US | 42 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 40 |
| Tampa, US | 40 |
| Saint Louis, US | 39 |
| Dover, US | 37 |
| Bangkok, TH | 36 |
| McWane Science Centerlocation not on record | 34 |
| University of Wisconsinlocation not on record | 32 |
| University of Toronto Mississaugalocation not on record | 30 |
| Museum of the Rockieslocation not on record | 30 |
| Corvallis, US | 29 |
| San Angelo, US | 29 |
| Green Bay, US | 25 |
| Université Lavallocation not on record | 24 |
| Chapel Hill, US | 24 |
| Phoenix, US | 23 |
| Denver, US | 23 |
| Williamsburg, US | 23 |
| Durham, US | 22 |
| Philadelphia, US | 20 |
| Dekalb, US | 20 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 20 |
| Vancouver, CA | 19 |
| ASUlocation not on record | 19 |
| Chadron, US | 19 |
| Montréal, CA | 17 |
| Auckland, NZ | 16 |
| Chicago, US | 15 |
| Moscow, US | 15 |
| Christchurch, NZ | 14 |
| Staten Island, US | 13 |
| WTUlocation not on record | 13 |
| St. Paul, US | 12 |
| Keene State Universitylocation not on record | 11 |
| Pittsburg, US | 10 |
| Odawara, JP | 9 |
| GB | 8 |
| Victoria, CA | 8 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 8 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 7 |
| Mississippi State, US | 7 |
| Whitewater, US | 7 |
| Missoula, US | 7 |
| Logan, US | 6 |
| Millersville, US | 6 |
| Lord Fairfax Community Collegelocation not on record | 6 |
| Davenport, US | 6 |
| MeiseBGlocation not on record | 6 |
| Columbia, US | 5 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 5 |
| Meguro Parasitological Museumlocation not on record | 5 |
| Portland, US | 5 |
| Naturalis Biodiversity Centerlocation not on record | 5 |
| Maryland Department of Natural Resourceslocation not on record | 4 |
| University of Southern Mississippilocation not on record | 4 |
| Norfolk, US | 4 |
| JP | 4 |
| BRNUlocation not on record | 4 |
| Royal Botanical Gardenslocation not on record | 4 |
| Riverside, US | 4 |
| Oswego, US | 4 |
| Hamilton, US | 4 |
| WINlocation not on record | 4 |
| Richmond, US | 3 |
| Hobart, AU | 3 |
| Elikins, US | 3 |
| DULlocation not on record | 3 |
| Mount Annan, AU | 3 |
| Mohonk Preservelocation not on record | 3 |
| BAYLUlocation not on record | 3 |
| Spearfish, US | 3 |
| Angwin, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Sanda, JP | 3 |
| Pullman, US | 3 |
| Rotorua, NZ | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Canberra, AU | 2 |
| Johnson City, US | 2 |
| Hokkaido University Botanic Gardenlocation not on record | 2 |
| Armidale, AU | 2 |
| Valdosta State Universitylocation not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| University of Western Ontariolocation not on record | 2 |
| GAlocation not on record | 2 |
| New Brunswick, US | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Beijing, CN | 2 |
| Morgantown, US | 2 |
| GJOlocation not on record | 2 |
| Claremont, US | 2 |
| Kew, GB | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Ypsilanti, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Fort Worth, US | 2 |
| Provo, US | 2 |
| Chicago, US | 2 |
| Whitehorse, CA | 2 |
| Wlocation not on record | 2 |
| Minia, EG | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Bothell, US | 1 |
| Lubbock, US | 1 |
| San Luis Obispo, US | 1 |
| Frankfurt am Main | 1 |
| US | 1 |
| Boise, US | 1 |
| Barcelona, ES | 1 |
| Kingston, US | 1 |
| Wellington, NZ | 1 |
| Portland, US | 1 |
| Knoxville, US | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Bourges, FR | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Durango, US | 1 |
| Tomioka, JP | 1 |
| Cambridge, US | 1 |
| Tsukuba, JP | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Delaware State University, Claude E. Phillips Herbariumlocation not on record | 1 |
| Kirksville, US | 1 |
| Bozeman, US | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Bando, JP | 1 |
| Pocatello, US | 1 |
| Northridge, US | 1 |
| MAlocation not on record | 1 |
| Fairfax, US | 1 |
| EL PASO, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Fayetteville, US | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| BClocation not on record | 1 |
| Caldwell, US | 1 |
| Tacoma, US | 1 |
| Clemson, US | 1 |
| Cheney, US | 1 |
| University of Winnipeglocation not on record | 1 |
| Marshall Universitylocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| AUAlocation not on record | 1 |
| Tuscaloosa, US | 1 |
175 institutions · 4 262 of 4 274 vouchered records shown · 10 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA33 detections
Where the DNA of Carex scoparia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found33
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 33 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.6 °C 13.7–19.2
Seasonal swing summer↔winter15.7 °C
Max temp (day)20.1 °C 16.9–24.4
Min temp (night)11.6 °C 10.2–15.4
Precipitation79.3 mm/mo 66.0–130
Air humidity60.5 % 57.7–63.5
Moisture balance-33.7 mm/mo -56.0–4.40
Vapour deficit706 Pa 583–925
Wind speed3.50 m/s 2.70–4.90
Cloud cover43.2 % 36.7–50.4
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.