Carex scabriuscula

Mack. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records233

Data sources8

Biological traits10

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Carex scabriuscula's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility233 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF233 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Carex scabriuscula adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex scabriuscula sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Mack..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex scabriuscula has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences3

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK581408.1 ↗588 bpUSA

ACGT

TCGTTGCCTTTACAAAAACACGACCGTCGAACACGTGATAGAATGCTGCCGTGGAGGCGCCTGTCGCCTCCTCGGCCCCACCGGCCTCCT …

Carex scabriuscula isolate B639 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type233 records

Wild obs. + sensor18

Museum / vouchered215

Range

Area of Occupancy AOO400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 14

14 georeferenced · 4 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 23≤1 km 105≤10 km 22>10 km 2

152 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence215

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	65
Denver, US	36
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	35
CASlocation not on record	26
Corvallis, US	9
STNFlocation not on record	8
WTUlocation not on record	5
Davis, US	5
Ann Arbor, US	4
US	3
Chicago, US	2
Dover, US	2
Delaware State University, Claude E. Phillips Herbariumlocation not on record	2
Flagstaff, US	1
Ashland, US	1
Bronx, US	1
San Angelo, US	1
University of Stellenboschlocation not on record	1
San Diego, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
St. Paul, US	1
Santa Barbara, US	1
KNFHClocation not on record	1

23 institutions · 212 of 215 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Carex scabriuscula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 19.8–21.6

Seasonal swing summer↔winter21.5 °C

Max temp (day)28.9 °C 28.1–29.6

Min temp (night)11.8 °C 11.2–12.3

Precipitation7.70 mm/mo 5.50–9.90

Air humidity43.9 % 43.6–44.2

Moisture balance-171 mm/mo -180–-162

Vapour deficit1,379 Pa 1,297–1,461

Wind speed2.10 m/s 2.00–2.30

Cloud cover20.4 % 15.9–24.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)