Carex saximontana

Mack. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records254

Data sources8

Biological traits10

DNA specimens12

eDNA detections11

Sources8 archives

Databases and archives Carex saximontana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF254 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB2n = 64

01Narrative

Carex saximontana adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex saximontana sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Mack..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex saximontana has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes5

GenBank sequences10

eDNA detections11

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF027454.1 ↗239 bpCanada

ACGT

CCTCATGGGCGTTAGAAGCCCATCCACGCTCAGTTGCCTCACGGCAAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCC …

Carex saximontana country Canada:Saskatchewan 5.8S ribosomal RNA gene, partial sequence; and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★rbcLa★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex saximontana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Chromosome records64–642n range64median64mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 642×CCDB · cyper-only · CCDB · ipcn-api-dl

CCDB · cyper-only — Lve, . & D. Lve1981

CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.

08Occurrence & distribution

Record type254 records

Wild obs. + sensor16

Museum / vouchered238

Range

Area of Occupancy AOO808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 10>10 km 5

15 georeferenced · 1 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 20≤1 km 90≤10 km 25>10 km 7

142 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	70
Wuzhou, CN	26
Chadron, US	26
Lincoln, US	24
WINlocation not on record	9
Missoula, US	8
Chicago, US	8
Madison, US	6
Denver, US	6
Spearfish, US	5
DULlocation not on record	4
Musee des Dinosaures d'Esperaza (Aude)location not on record	3
International Salmonella Centre (W.H.O.)location not on record	3
New Haven, US	3
Boise, US	2
Bronx, US	2
University of Alberta Museumslocation not on record	2
AUAlocation not on record	2
USFS/BHSClocation not on record	2
Chongqing Museumlocation not on record	2
Moscow State Universitylocation not on record	2
Claremont, US	1
CSBSJUlocation not on record	1
Moscow, US	1
Pullman, US	1
University of Toronto Mississaugalocation not on record	1
Karlsruhe, DE	1
Chapel Hill, US	1
Wellington, NZ	1
Delaware State University, Claude E. Phillips Herbariumlocation not on record	1
Ann Arbor, US	1
Paris, FR	1
Provo, US	1
Toronto, CA	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
University of Wisconsinlocation not on record	1

36 institutions · 230 of 238 vouchered records shown · 3 without an institution code

09Environmental DNA11 detections

Where the DNA of Carex saximontana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-4.40 °C -4.40–11.5

Seasonal swing summer↔winter41.0 °C

Max temp (day)-1.10 °C -1.10–16.6

Min temp (night)-6.50 °C -6.50–7.90

Precipitation54.0 mm/mo 54.0–74.0

Air humidity65.1 % 57.0–65.1

Moisture balance-1.80 mm/mo -53.7–-1.80

Vapour deficit269 Pa 269–613

Wind speed5.60 m/s 4.80–5.60

Cloud cover57.6 % 48.2–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)