Carex saxatilis
speciesAt a glance
Occurrence records13 586
Data sources11
Biological traits112
DNA specimens114
eDNA detections63
Sources11 archives
Databases and archives Carex saxatilis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 586 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics114 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources112 traits
Occurrence & distributionGBIF13 586 records
Environmental DNA1 datasets · 8 countries63 detections
DNA & barcodingBOLD · NCBI114 specimens
Genome at a glanceCCDB499 Mbp
01Narrative
Carex saxatilis, le Carex saxatile, est une espèce de plantes du genre Carex. Elle a une distribution circumboréale.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology10
Leaf mass26.1 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 386 mm² · GIFT: 356 mm²
Plant height0.367 m
⚠ sources differ — GIFT: 0.367 m · LEDA: 0.125 m · USDA: 0.61 m · TRY: 0.133 m
Plant height generative0.163 m
Plant height max0.7 m
Plant height min0.1 m
Seed length2 mm
Seed mass0.749 mg
⚠ sources differ — TRY: 0.749 mg · LEDA: 0.845 mg · GIFT: 0.828 mg
Seed mass max1.07 mg
Seed mass min0.61 mg
Life cycle & reproduction27
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Dispersal typewater
Flower colourbrown
Flower conspicuousNo
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifeform raunkiaer detailedgeophyte
Lifespan categoryModerate
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityNo
Seed number56.5
Seed spread rateSlow
Seedling vigorLow
Vegetative spread rateRapid
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Growth formherb
Growth form USDARhizomatous
Habitat GIFTshores
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min95 days
Leaf C:N ratio18.74 g/g
Leaf c543 mg/g
Leaf dry-matter content (LDMC)332 mg/g
Leaf n27.92 mg/g
Leaf p1.07 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max100 in
Precipitation min8 in
Protein potentialLow
Salinity toleranceMedium
Seed longevity index0
Shade toleranceMedium
Soil pH max8 pH
Soil pH min6.1 pH
Specific leaf area (SLA)13.21 mm²/mg
⚠ sources differ — TRY: 13.21 mm²/mg · LEDA: 10.88 mm²/mg · GIFT: 11.89 mm²/mg
Temperature min-28 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max2 700 per acre
Planting density min1 700 per acre
05DNA & barcoding114 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex saxatilis has left across the world's sequence archives.
At a glance
DNA specimens114
Marker genes11
GenBank sequences10
eDNA detections63
Countries9
The DNA barcodea real sequence read deposited for this species
TCGTTGCCTTTCCAGAAACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCTTGCCGCCTCCTCGGCCCCGCCGGCCTCCT …
Carex saxatilis isolate B616 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★trnL-F★ITS2★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Carex saxatilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size498 780 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex saxatilis0.50 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 80 n = 40
Ploidypolyploid inferred
Chromosome records40–802n range80median80mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 8024×CCDB · nw-europe-fl · CCDB · fl-europaea · CCDB · cyper-only +5
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4355
CCDB · fl-europaea — Knaben & Engelskjon
CCDB · cyper-only — Lve, . & D. Lve1956
CCDB · cyper-only — Knaben, G. & T. Engelskjon1967
CCDB · cyper-only — 174Zhukova, P. G. & A. D. Tikhonova1971
CCDB · cyper-only — 174Krogulevich, R. E.1976
CCDB · cyper-only — 174Zhukova, P. G. & V. V. Petrovsky1976
CCDB · cyper-only — Zhukova, P. G., A. A. Korobkov & A. D. Tikhonova1977
CCDB · cyper-only — Yurtsev, B. A. & P. G. Zhukova1978
CCDB · cyper-only — Engelskjon, T.1979
CCDB · cyper-only — 174Lve, . & D. Lve1981
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1978. The cytotaxonomical survey of the monocots of the easternmost Chokchi Peninsula. Bot. Žhurn. (Moscow & Leningrad) 63(8): 1132–1144.
CCDB · ipcn-api-dl — ZHUKOVA, P. G., A. A. KOROBKOV & A. D. TIKHONOVA. 1977. Chromosome numbers of some plant species in the eastern Arctic Yakuta. Bot. Žhurn. (Moscow & Leningrad) 62(2): 229–234.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.
CCDB · book-ipcn75-78 — Zhukova et al. 1977a
CCDB · book-ipcn75-78 — Yurtsev & Zhukova 1978
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976
CCDB · book-northern-plants — Flovik 1943, Heilborn 1928.
CCDB · Cave1956 — Love & Love b
2n 604×CCDB · book-ipcn65 · CCDB · cyper-only · CCDB · book-ipcn66
CCDB · book-ipcn65 — Love & Love 1965b
CCDB · cyper-only — 173Lve, . & D. Lve1965a
CCDB · cyper-only — 173Lve, . & J. C. Ritchie1966
CCDB · book-ipcn66 — Love & Ritchie 1966
2n 403×CCDB · cyper-only · CCDB · ipcn-api-dl
CCDB · cyper-only — 172Lve, .1954a
CCDB · cyper-only — 172Lve, . & D. Lve1981
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
2n 522×CCDB · cyper-only · CCDB · book-ipcn73-74
CCDB · cyper-only — 174Zhukova, P. G., V. V. Petrovsky & T. N. Plieva1973
CCDB · book-ipcn73-74 — ZHUKOVA, P.G., V.V. PETROVSKY, & T.N. PLIEVA. 1973. The chromosome numbers and taxonomy of some plant species from Siberia and Far East. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1331-1342.
n 404×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · Cave1958
CCDB · cyper-only — Jorgensen, C. A., T. Sorensen & M. Westergaard1958
CCDB · cyper-only — Dalgaard, V.1989
CCDB · ipcn-api-dl — Dalgaard, V. 1989. Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199–213.
CCDB · Cave1958 — Jorgensen et al. 1958
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type13 586 records
Wild obs. + sensor8 382
Museum / vouchered5 199
Other5
Origin
Native692
Range
Area of Occupancy AOO28 520 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy77% within 1 km
≤100 m 4 237≤1 km 1 497≤10 km 1 486>10 km 212
7 432 georeferenced · 950 without coordinates
Open the mapobservation + sensor8 382
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 402≤1 km 906≤10 km 769>10 km 588
2 665 georeferenced · 2 534 without coordinates
Open the institutions mapphysical evidence5 199
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions67 of 121 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Trondheim, NO | 478 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 449 |
| Olocation not on record | 410 |
| TROMlocation not on record | 399 |
| Uppsala, SE | 298 |
| LDlocation not on record | 298 |
| Moscow State Universitylocation not on record | 216 |
| South Kensington, GB | 188 |
| Garðabær, IS | 179 |
| University of Toronto Mississaugalocation not on record | 152 |
| Bergen, NO | 110 |
| Vancouver, CA | 109 |
| University of Stellenboschlocation not on record | 104 |
| Helsinki, FI | 103 |
| Québec, CA | 94 |
| Chongqing Museumlocation not on record | 85 |
| Montréal, CA | 80 |
| KMNlocation not on record | 74 |
| Ann Arbor, US | 71 |
| 68 | |
| Oskarshamn, SE | 66 |
| WTUlocation not on record | 60 |
| University of Alberta Museumslocation not on record | 56 |
| Oulu, FI | 56 |
| Chicago, US | 54 |
| Anchorage, US | 52 |
| Montréal, CA | 47 |
| Bronx, US | 45 |
| Toronto, CA | 45 |
| SLU Artdatabankenlocation not on record | 39 |
| Victoria, CA | 37 |
| Missoula, US | 36 |
| Madison, US | 34 |
| Université Lavallocation not on record | 31 |
| Irkutsk State Universitylocation not on record | 31 |
| Provo, US | 30 |
| St. Paul, US | 25 |
| nbflocation not on record | 24 |
| Saint Louis, US | 21 |
| Yukon Universitylocation not on record | 21 |
| Kuopio, FI | 20 |
| Moscow, US | 17 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 17 |
| Stockholm, SE | 16 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 16 |
| Whitehorse, CA | 14 |
| Tromso University Museumlocation not on record | 13 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 11 |
| NMBU:MINAlocation not on record | 10 |
| IWEP FEB RASlocation not on record | 10 |
| BRNUlocation not on record | 8 |
| GINRlocation not on record | 7 |
| TUR-Alocation not on record | 7 |
| Acadia Universitylocation not on record | 7 |
| University of Manitoba Herbariumlocation not on record | 7 |
| Pullman, US | 7 |
| Phoenix, US | 7 |
| Durango, US | 6 |
| Turku, FI | 6 |
| Burlington, US | 5 |
| Canadian Museum of Nature, Natural Heritage Buildinglocation not on record | 5 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Kew, GB | 5 |
| Canadian Museum of Naturelocation not on record | 5 |
| University of Winnipeglocation not on record | 5 |
| Corvallis, US | 5 |
| Royal Botanic Garden Edinburghlocation not on record | 5 |
| Göteborg, SE | 4 |
| Kandalaksha State Nature Reservelocation not on record | 4 |
| University of Hulllocation not on record | 4 |
| PTHlocation not on record | 4 |
| Auckland, NZ | 4 |
| Christchurch, NZ | 4 |
| Davis, US | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| Dresden, DE | 3 |
| Saint John, CA | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Bozeman, US | 3 |
| Wellington, NZ | 3 |
| Chapel Hill, US | 3 |
| Claremont, US | 3 |
| Umeå Universitylocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Pittsburg, US | 2 |
| University of Helsinkilocation not on record | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| Tartu, EE | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Wlocation not on record | 2 |
| Bloomington, US | 2 |
| Wuzhou, CN | 2 |
| Porvoo, FI | 2 |
| Denver, US | 2 |
| Flagstaff, US | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Salzburg, AT | 2 |
| BClocation not on record | 1 |
| Caldwell, US | 1 |
| Chicago, US | 1 |
| National Museum Waleslocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Oregon State Universitylocation not on record | 1 |
| Millersville, US | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Görlitz, DE | 1 |
| Knoxville, US | 1 |
| Delaware State University, Claude E. Phillips Herbariumlocation not on record | 1 |
| Dover, US | 1 |
| AUAlocation not on record | 1 |
| Madrid, ES | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Dekalb, US | 1 |
| Albuquerque, US | 1 |
| Mississippi State, US | 1 |
| Trois-Rivières, CA | 1 |
| NMWlocation not on record | 1 |
| Orem, US | 1 |
| Boise, US | 1 |
121 institutions · 5 127 of 5 199 vouchered records shown · 70 without an institution code
09Environmental DNA63 detections
Where the DNA of Carex saxatilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found63
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 63 detections have coordinates
Open the map8 countries0
MontaneSedge (Carex rariflora â Eriophorum angust…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.50 °C 3.20–12.8
Seasonal swing summer↔winter25.0 °C
Max temp (day)11.0 °C 4.00–18.1
Min temp (night)5.90 °C 0.7–8.60
Precipitation85.7 mm/mo 35.4–127
Air humidity64.8 % 56.4–69.5
Moisture balance4.90 mm/mo -59.9–49.6
Vapour deficit409 Pa 287–562
Wind speed3.90 m/s 3.00–6.10
Cloud cover55.9 % 43.1–74.3
CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.