Carex satsumensis

Franch. & Sav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records236

Data sources8

Biological traits9

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Carex satsumensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility236 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF236 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Carex satsumensis ist eine Sauergrasart. Sie ist ein relativ kleinwüchsiger Vertreter der Gattung der Seggen (Carex) und die einzige Art der Sektion Japonicae. Sie wächst auf sandigen Böden und ist auf Taiwan, Japan, den Philippinen und in Vietnam beheimatet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex satsumensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAB725728.1 ↗608 bpJapan

ACGT

TCGTTGCCTTTCGAAAAACACGACCGTTGCACACGTGACAGAACGCTGTCGGGGAGGTGCTTGCTGCCTCCTCGGCCCCACCGGCCTCTT …

Carex satsumensis genes for ITS1, 5.8S ribosomal RNA, ITS2, partial and complete sequence, specimen_voucher: OKAY:T. Hoshino et al. 17917

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex satsumensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hoshino, T. 1981a. Karyomorphological and cytogenetical studies on aneuploidy in Carex. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 2, 17: 155–238.

08Occurrence & distribution

Record type236 records

Wild obs. + sensor30

Museum / vouchered206

Origin

Native6

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 12≤1 km 4>10 km 2

18 georeferenced · 12 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤1 km 5≤10 km 46

51 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Shinshu Universitylocation not on record	35
Kochi, JP	28
Taipei, TW	20
Tsukuba, JP	19
Tokushima, JP	17
Nagano City, JP	15
Taipei, TW	11
Chiba, JP	10
Sendai, JP	9
TAIElocation not on record	6
Osaka, JP	5
Taipei, TW	5
Museum Of Natural And Environmental History, Shizuokalocation not on record	4
Kunming, CN	3
Toyama, JP	3
SIHUlocation not on record	3
J.F.Oberlin Universitylocation not on record	3
Nishihara, JP	1
Tomioka, JP	1
Omachi Alpine Museumlocation not on record	1
Beijing, CN	1
Otaru, JP	1
Nishihara, JP	1
Kagoshima, JP	1
KIRMlocation not on record	1
Edinburgh, GB	1

26 institutions · 205 of 206 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Carex satsumensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)