Carex ruthii

Mack. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records80

Data sources6

Biological traits10

DNA specimens6

eDNA detections6

Sources6 archives

Databases and archives Carex ruthii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF80 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Carex ruthii adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex ruthii sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Mack..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex ruthii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences3

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ115264.1 ↗612 bpUSA

ACGT

TCGTTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGAACATGCTGCCGGGGAGGTGCTTGCTGCCTCCTCGGCCCCACCGGCCTC …

Carex ruthii Noel & Zartman s.n. (MICH) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type80 records

Wild obs. + sensor14

Museum / vouchered66

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 13

13 georeferenced · 1 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 6≤1 km 14≤10 km 15>10 km 3

38 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jackson, US	7
Chapel Hill, US	7
Ann Arbor, US	6
San Angelo, US	6
Madison, US	5
Bloomington, US	5
Knoxville, US	4
Bangkok, TH	3
Saint Louis, US	2
Durham, US	2
Valdosta State Universitylocation not on record	2
GAlocation not on record	2
Wuzhou, CN	1
WTUlocation not on record	1
Chicago, US	1
Jena Microbial Resource Collectionlocation not on record	1
Moscow, US	1
Dover, US	1
Beijing, CN	1
Pondicherry, IN	1
Oregon State Universitylocation not on record	1
Delaware State University, Claude E. Phillips Herbariumlocation not on record	1
Williamsburg, US	1
Fairfax, US	1
Auckland, NZ	1
Bronx, US	1
Boise, US	1

27 institutions · 66 of 66 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Carex ruthii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 18.0–18.0

Seasonal swing summer↔winter20.4 °C

Max temp (day)22.8 °C

Min temp (night)13.5 °C

Precipitation132 mm/mo

Air humidity61.8 %

Moisture balance-8.70 mm/mo

Vapour deficit785 Pa

Wind speed2.40 m/s

Cloud cover32.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)