Carex rupestris
All. · speciesAt a glance
Occurrence records16 190
Data sources9
Biological traits33
DNA specimens125
eDNA detections80
Sources9 archives
Databases and archives Carex rupestris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility16 190 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI80 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics125 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources33 traits
Occurrence & distributionGBIF16 190 records
Environmental DNA2 datasets · 8 countries80 detections
DNA & barcodingBOLD · NCBI125 specimens
Genome at a glanceCCDB · GoaT401 Mbp
01Narrative
Turzyca skalna – gatunek byliny z rodziny ciborowatych.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology7
Leaf mass3.05 mg
Leaf size128 mm²
⚠ sources differ — TRY: 128 mm² · LEDA: 31.05 mm² · GIFT: 31.05 mm²
Plant height0.075 m
⚠ sources differ — GIFT: 0.075 m · LEDA: 0.075 m · TRY: 0.046 m
Plant height generative0.1 m
Plant height max0.2 m
Plant height min0.05 m
Seed length3.5 mm
Life cycle & reproduction8
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typewind
Flowering endAug
Flowering startJun
Life formperennial or rhizomatous geophyte
Life spanperennial
Raunkiær life formhemicryptophyte
Seed number2.6
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Graminoid
Habitat GIFTmountains, stony places
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio22.29 g/g
Leaf c433 mg/g
Leaf dry-matter content (LDMC)361 mg/g
Leaf n18.07 mg/g
Leaf p1.76 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)12.91 mm²/mg
⚠ sources differ — TRY: 12.91 mm²/mg · LEDA: 11.99 mm²/mg · GIFT: 11.99 mm²/mg
Other traits1
Diaspore typefruit with appendage
05DNA & barcoding125 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex rupestris has left across the world's sequence archives.
At a glance
DNA specimens125
Marker genes10
GenBank sequences10
eDNA detections80
Countries10
The DNA barcodea real sequence read deposited for this species
TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGAATGCTGCCGGGGAGGT …
Carex rupestris isolate STA1581 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL5★rbcLa★ITS1★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Carex rupestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size400 980 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex rupestris0.40 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 50 n = 25
Chromosome records48–522n range50median50mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5011×GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea · CCDB · cyper-only +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · fl-europaea — Favarger, 1959
CCDB · cyper-only — Lve, . & D. Lve1956
CCDB · cyper-only — Zhukova, P. G. & V. V. Petrovsky1971
CCDB · cyper-only — Zhukova, P. G. & V. V. Petrovsky1987
CCDB · book-ipcn67-71 — ZHUKOVA, P.G., & V.V. PETROVSKY. 1971. Chromosome numbers of certain flowering plants of the Wrangel island. (In Russian). Bot. Zurn. 56: 294-305.
CCDB · book-northern-plants — Heil born 1928, Flovik 1943.
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Agapova, N. D., Arkharova, K. B., Zemskova, L. I. & Tarvis, L. V. (1990). Numeri chromosomatum Magnoliophytorum Florae URSS. 1. A. Takhtajan Leningrad
CCDB · CromoCat 2015 — Petrovsky, V. & P. Zhukova. (1978). Cytotaxonomical survey of monocotyledonous plants in Vrangel island. Bot. Žurn. 63: 1258-1273.
CCDB · CromoCat 2015 — Váchová, M. (1978). Index of chromosome numbers of Slovakian flora. (Part 6). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1-42.
2n 5210×CCDB · fl-europaea · CCDB · cyper-only · CCDB · ipcn-api-dl +3
CCDB · fl-europaea — Knaben f, Engelskjon
CCDB · cyper-only — Knaben, G. & T. Engelskjon1967
CCDB · cyper-only — Lve, . & D. Lve1981
CCDB · cyper-only — Druskovic, L. P.1995
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
CCDB · book-northern-plants — S. & W. (unpubl.).
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1981a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 845-851.
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
2n 484×CCDB · mediterranean · CCDB · cyper-only · CCDB · ipcn-api-dl +1
CCDB · mediterranean
CCDB · cyper-only — Stoeva, M. P.1994
CCDB · ipcn-api-dl — Stoeva, M. 1994. Mediterranean chromosome number reports 4 (285--293). Fl. Medit. 4: 258–262.
CCDB · CromoCat 2015 — Stoeva, M. P. (1994). Reports (285-293). Fl. Medit. 4: 258-262.
n 262×CCDB · cyper-only · CCDB · Cave1958
CCDB · cyper-only — Jorgensen, C. A., T. Sorensen & M. Westergaard1958
CCDB · Cave1958 — Jorgensen et al. 1958
n 251×CCDB · cyper-only
CCDB · cyper-only — Favarger, C.1959
08Occurrence & distribution
Record type16 190 records
Wild obs. + sensor11 817
Museum / vouchered4 300
Cultivated / captive1
Other72
Origin
Native361
Range
Area of Occupancy AOO25 880 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy54% within 1 km
≤100 m 4 179≤1 km 1 302≤10 km 4 096>10 km 585
10 162 georeferenced · 1 655 without coordinates
Open the mapobservation + sensor11 817
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 342≤1 km 854≤10 km 1 144>10 km 357
2 697 georeferenced · 1 603 without coordinates
Open the institutions mapphysical evidence4 300
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions81 of 154 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 741 |
| Trondheim, NO | 477 |
| TROMlocation not on record | 444 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 249 |
| LDlocation not on record | 207 |
| Uppsala, SE | 183 |
| Bergen, NO | 114 |
| Moscow State Universitylocation not on record | 110 |
| South Kensington, GB | 102 |
| Helsinki, FI | 91 |
| Garðabær, IS | 81 |
| Montréal, CA | 60 |
| 60 | |
| Oskarshamn, SE | 53 |
| University of Alberta Museumslocation not on record | 51 |
| Oulu, FI | 50 |
| Missoula, US | 43 |
| Québec, CA | 39 |
| Salzburg, AT | 38 |
| Irkutsk State Universitylocation not on record | 37 |
| Turku, FI | 37 |
| Zürich, CH | 36 |
| Bronx, US | 33 |
| Denver, US | 30 |
| Barcelona, ES | 28 |
| Vancouver, CA | 28 |
| University of Toronto Mississaugalocation not on record | 28 |
| Université Lavallocation not on record | 24 |
| Zürich, CH | 23 |
| University of Stellenboschlocation not on record | 22 |
| KMNlocation not on record | 21 |
| SLU Artdatabankenlocation not on record | 20 |
| Copenhagen, DK | 20 |
| BRNUlocation not on record | 19 |
| Moscow, US | 18 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 18 |
| Chongqing Museumlocation not on record | 18 |
| Albuquerque, US | 17 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 17 |
| Chicago, US | 17 |
| Ann Arbor, US | 16 |
| Victoria, CA | 15 |
| Madison, US | 15 |
| Rocky Mountain Biological Laboratorylocation not on record | 15 |
| BDBClocation not on record | 14 |
| Montréal, CA | 14 |
| GJOlocation not on record | 14 |
| WINlocation not on record | 13 |
| Saint Louis, US | 12 |
| DOI/NPS, Greenbelt Parklocation not on record | 11 |
| TUR-Alocation not on record | 11 |
| Anchorage, US | 11 |
| Whitehorse, CA | 11 |
| St. Paul, US | 10 |
| WTUlocation not on record | 10 |
| MAlocation not on record | 10 |
| Yukon Universitylocation not on record | 10 |
| BClocation not on record | 10 |
| Kuopio, FI | 9 |
| Vitoria, ES | 9 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 9 |
| Provo, US | 9 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 9 |
| Entomological Society of Latvialocation not on record | 9 |
| Wuzhou, CN | 9 |
| Wellington, NZ | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Canadian Museum of Naturelocation not on record | 7 |
| San Sebastián, ES | 7 |
| Hokkaido University Museumlocation not on record | 6 |
| nbflocation not on record | 6 |
| Kyoto Universitylocation not on record | 6 |
| Kew, GB | 5 |
| Tromso University Museumlocation not on record | 5 |
| Jyväskylä, FI | 5 |
| Bozeman, US | 5 |
| BFLlocation not on record | 4 |
| Flagstaff, US | 4 |
| Provincia di Livornolocation not on record | 4 |
| Acadia Universitylocation not on record | 4 |
| Royal Botanic Garden Edinburghlocation not on record | 4 |
| University of Winnipeglocation not on record | 4 |
| Auckland, NZ | 4 |
| Phoenix, US | 4 |
| University of Lethbridgelocation not on record | 4 |
| Tsukuba, JP | 4 |
| Görlitz, DE | 4 |
| University of Manitoba Herbariumlocation not on record | 4 |
| Dhaka, BD | 4 |
| Christchurch, NZ | 4 |
| Bourges, FR | 3 |
| Museum of the Rockieslocation not on record | 3 |
| BioFokuslocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Wlocation not on record | 3 |
| Karlsruhe, DE | 3 |
| Trois-Rivières, CA | 3 |
| Canadian Museum of Nature, Natural Heritage Buildinglocation not on record | 3 |
| Emporia, US | 3 |
| Tampa, US | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Porvoo, FI | 3 |
| University of Helsinkilocation not on record | 3 |
| College Park, US | 3 |
| Glarus, CH | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| BIO-UNIPIlocation not on record | 2 |
| San Angelo, US | 2 |
| Dresden, DE | 2 |
| Stockholm, SE | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Umeå Universitylocation not on record | 2 |
| Oregon State Universitylocation not on record | 2 |
| University of Hulllocation not on record | 2 |
| Toronto, CA | 2 |
| SZUlocation not on record | 2 |
| Logan, US | 2 |
| Paris, FR | 2 |
| UnBlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| BSBIlocation not on record | 1 |
| NMWlocation not on record | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Davis, US | 1 |
| GB | 1 |
| Bern, CH | 1 |
| PRClocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Durango, US | 1 |
| Bloomington, US | 1 |
| CJBGlocation not on record | 1 |
| Göteborg, SE | 1 |
| Pullman, US | 1 |
| Tacoma, US | 1 |
| Jaén, ES | 1 |
| MeiseBGlocation not on record | 1 |
| Columbia, US | 1 |
| Boise, US | 1 |
| Frankfurt am Main | 1 |
| Lausanne, CH | 1 |
| València, ES | 1 |
| Orem, US | 1 |
| University of Western Ontariolocation not on record | 1 |
| PTHlocation not on record | 1 |
| Madrid, ES | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Salamanca, ES | 1 |
| Pamplona, ES | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Alicante, ES | 1 |
| IPE-CSIClocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
154 institutions · 4 218 of 4 300 vouchered records shown · 79 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA80 detections
Where the DNA of Carex rupestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found80
Studies independent surveys2
Countries8
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 80 detections have coordinates
Open the map8 countries0
Rare Plants Nursery, Cultivated from wild so…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.80 °C 0.1–12.0
Seasonal swing summer↔winter25.5 °C
Max temp (day)11.0 °C 0.8–16.2
Min temp (night)6.10 °C -2.50–7.80
Precipitation63.4 mm/mo 12.6–122
Air humidity62.4 % 55.8–70.1
Moisture balance-7.50 mm/mo
Vapour deficit386 Pa 267–571
Wind speed4.90 m/s
Cloud cover53.5 % 37.0–65.0
CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.