Carex rugulosa

Kük. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records217

Data sources6

Biological traits15

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Carex rugulosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility207 records↗

OBISOcean Biodiversity Information System10 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF · OBIS217 records

DNA & barcodingNCBIsequences

01Narrative

Carex rugulosa, also known as the thick-nerve sedge or the slender-culm thick-nerve sedge, is a tussock-forming perennial in the family Cyperaceae. It is native to eastern parts of Asia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.8 m

Plant height min0.5 m

Life cycle & reproduction5

Flowering endJun

Flowering startJun

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmeadows, sand

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex rugulosa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN761925.1 ↗717 bp

ACGT

TAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGCCTTTCCAGAAACACGACCGTCGAAC …

Carex rugulosa isolate spm00000348 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type217 records

Wild obs. + sensor91

Museum / vouchered126

Origin

Native1

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤100 m 1≤1 km 3≤10 km 1>10 km 63

68 georeferenced · 23 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 46>10 km 1

48 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	46
Irkutsk State Universitylocation not on record	18
Chiba, JP	16
National Marine Biodiversity Institute of Korealocation not on record	9
ifplocation not on record	4
National Institute of Biological Resourceslocation not on record	2
Northeastern Forestry Universitylocation not on record	2
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	2
Inner Mongolia Universitylocation not on record	2
Hokkaido University Museumlocation not on record	1
Moscow State Universitylocation not on record	1
MAlocation not on record	1
Urumqi, CN	1
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	1
Wlocation not on record	1
WoRMS Editorial Boardlocation not on record	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1
Nishihara, JP	1
Sanda, JP	1
Xining, CN	1

20 institutions · 112 of 126 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)