Carex rostrata
Stokes · speciesAt a glance
Occurrence records326 809
Data sources10
Biological traits122
DNA specimens71
eDNA detections38
Sources10 archives
Databases and archives Carex rostrata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility326 809 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics71 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources122 traits
Occurrence & distributionGBIF326 809 records
Environmental DNA1 datasets · 7 countries38 detections
DNA & barcodingBOLD · NCBI71 specimens
Genome at a glanceCCDB · GoaT · NCBI440 Mbp
01Narrative
Carex rostrata, la Laîche en ampoules, est une plante herbacée que l'on rencontre dans les zones humides, de la famille des cypéracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology10
Leaf mass76.97 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 1 176 mm² · GIFT: 1 182 mm²
Plant height0.8 m
⚠ sources differ — GIFT: 0.8 m · LEDA: 0.5 m · USDA: 1.07 m · TRY: 0.525 m
Plant height generative0.477 m
Plant height max1 m
Plant height min0.25 m
Seed length3.17 mm
Seed mass1.13 mg
⚠ sources differ — TRY: 1.13 mg · LEDA: 1.06 mg · GIFT: 1.2 mg
Seed mass max1.44 mg
Seed mass min0.97 mg
Life cycle & reproduction35
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessn.d.
⚠ sources differ — TRY: n.d. · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typewater
Flower colourbrown
Flower conspicuousNo
Flowering endJun
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryModerate
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number116
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Vegetative spread rateModerate
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment27
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Growth form USDARhizomatous
Habitat GIFTcanals, meadows: wet, shores
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typenon-mycorrhizal
Root depth min16 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min80 days
Leaf C:N ratio21.78 g/g
Leaf c492 mg/g
Leaf dry-matter content (LDMC)296 mg/g
⚠ sources differ — TRY: 296 mg/g · LEDA: 245 mg/g
Leaf n22.03 mg/g
Leaf p2.45 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max40 in
Precipitation min10 in
Protein potentialLow
Salinity toleranceLow
Seed longevity index0
Shade toleranceLow
Soil pH max7 pH
Soil pH min4.5 pH
Specific leaf area (SLA)14.65 mm²/mg
⚠ sources differ — TRY: 14.65 mm²/mg · LEDA: 15.34 mm²/mg · GIFT: 15.62 mm²/mg
Temperature min-38 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceYes
Planting density max4 800 per acre
Planting density min2 700 per acre
05DNA & barcoding71 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex rostrata has left across the world's sequence archives.
At a glance
DNA specimens71
Marker genes6
GenBank sequences10
eDNA detections38
Countries10
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Carex rostrata voucher EDNA21-0061098 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL2★rbcLa★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Carex rostrata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size440 100 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex rostrata0.44 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 76 n = 38
Chromosome records42–822n range76median76mode23records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 769×CCDB · slov-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +4
CCDB · slov-fl — Murín A. & Májovský J., 1976: [Report], pp. 487-488. - In: Löve Á. (ed.), IOPB Chromosome number reports LIII, Taxon 25 /4.
CCDB · fl-europaea — Murin & Majovsky,
CCDB · ipcn-api-dl — Murin, A. & J. Majovsky. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1975. Chromosome numbers of some Western Chukolka plant species. Bot. Žhurn. (Moscow & Leningrad) 60(3): 395–401.
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1975
CCDB · book-ipcn75-78 — Murin & Majovsky 1976
CCDB · book-atlas-flowering-plants
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Murín, A. & J. Májovský. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIII]. Taxon 25(4): 487-488.
2n 606×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · fl-europaea — Druskevic, ined.
CCDB · ipcn-api-dl — Stoeva, M. P. 1987. Chromosome numbers of Bulgarian angiosperms. Fitologija 33: 65–66.
CCDB · ipcn-api-dl — Kozhevnikov, A. E., A. P. Sokolovskaya & N. S. Probatova. 1986. Ecology, distribution and chromosome counts in some Cyperaceae from the Soviet far east. Izv. Sibirsk. Otd. Akad. Nauk SSSR, Ser. Biol. Nauk 2: 57–62.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
CCDB · CromoCat 2015 — Stoeva, M. P. (1987a). Chromosome numbers of Bulgarian Angiosperms. Fitologija 33: 65-66.
2n 722×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976
2n 802×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Cayouette, J. 1997. IOPB chromosome data 12. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 28: 13–14.
CCDB · CromoCat 2015 — Cayouette, J. (1997). IOPB Chromosome Data 12 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 28: 13-14.
2n 822×CCDB · fl-europaea · CCDB · book-atlas-flowering-plants
CCDB · fl-europaea — LOvqvist, 1963
CCDB · book-atlas-flowering-plants — Wahl 1940
2n 421×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Hayirlioğlu-Ayaz, S., A. Olgun & O. Beyazoğlu. 2001. Chromosome numbers of some Carex species from northeast Anatolia. Biologia (Bratislava) 56: 381–387.
2n 701×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Rotreklová, O. & Bureš, P. & ?epka, R. & Grulich, V. & Šmarda, P. & Hralová, I. & Zedek, F.& Koutecký, T. (2011). Chromosome numbers of Carex Preslia 83: 25–58
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness76.2% BUSCO
08Occurrence & distribution
Record type326 809 records
Wild obs. + sensor306 059
Museum / vouchered19 756
Cultivated / captive16
Fossil22
Other956
Origin
Native17 033
Introduced4
Range
Area of Occupancy AOO409 196 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 104 708≤1 km 67 216≤10 km 100 240>10 km 1 433
273 597 georeferenced · 32 462 without coordinates
Open the mapobservation + sensor306 059
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 1 242≤1 km 4 936≤10 km 5 882>10 km 2 197
14 257 georeferenced · 5 499 without coordinates
Open the institutions mapphysical evidence19 756
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy27% within 1 km
≤1 km 4>10 km 11
15 georeferenced · 1 without coordinates
Open the mapnot free-living16
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions134 of 251 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 748 |
| Helsinki, FI | 1 310 |
| Moscow State Universitylocation not on record | 886 |
| LDlocation not on record | 786 |
| Olocation not on record | 602 |
| Trondheim, NO | 508 |
| South Kensington, GB | 498 |
| Oulu, FI | 427 |
| Bronx, US | 372 |
| Uppsala, SE | 362 |
| TROMlocation not on record | 310 |
| Tartu, EE | 264 |
| Bergen, NO | 245 |
| MeiseBGlocation not on record | 227 |
| BRNUlocation not on record | 220 |
| Kuopio, FI | 200 |
| Turku, FI | 199 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 197 |
| Provincia di Livornolocation not on record | 196 |
| Québec, CA | 174 |
| SLU Artdatabankenlocation not on record | 169 |
| Toronto, CA | 158 |
| Université Lavallocation not on record | 149 |
| Oskarshamn, SE | 142 |
| Brussel, BE | 142 |
| Adam Mickiewicz University in Poznańlocation not on record | 132 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 127 |
| CJBGlocation not on record | 124 |
| Irkutsk State Universitylocation not on record | 116 |
| TUR-Alocation not on record | 113 |
| Garðabær, IS | 113 |
| Uniwersytet Śląski w Katowicachlocation not on record | 105 |
| KMNlocation not on record | 95 |
| Philadelphia, US | 94 |
| Kandalaksha State Nature Reservelocation not on record | 91 |
| Chicago, US | 88 |
| Madison, US | 82 |
| Jyväskylä, FI | 80 |
| Görlitz, DE | 73 |
| St. Paul, US | 69 |
| BOISlocation not on record | 69 |
| Entomological Society of Latvialocation not on record | 67 |
| University of Alberta Museumslocation not on record | 65 |
| Tallinn, EE | 60 |
| Chongqing Museumlocation not on record | 60 |
| DBF-NHMDlocation not on record | 60 |
| Wlocation not on record | 56 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 55 |
| Bern, CH | 55 |
| MAlocation not on record | 55 |
| GJOlocation not on record | 54 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 53 |
| Philadelphia, US | 51 |
| Yerevan, AM | 50 |
| Montréal, CA | 44 |
| 42 | |
| Green Bay, US | 42 |
| Arcata, US | 41 |
| University of Toronto Mississaugalocation not on record | 40 |
| University of Stellenboschlocation not on record | 40 |
| Ann Arbor, US | 38 |
| Angwin, US | 34 |
| Acadia Universitylocation not on record | 32 |
| Vancouver, CA | 32 |
| University of Wisconsinlocation not on record | 30 |
| WINlocation not on record | 30 |
| Provo, US | 30 |
| Dresden, DE | 29 |
| Barcelona, ES | 28 |
| Tampa, US | 27 |
| Victoria, CA | 25 |
| BIO-UNIPIlocation not on record | 24 |
| Frankfurt am Main | 24 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 23 |
| Montréal, CA | 23 |
| WTUlocation not on record | 22 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 22 |
| Oregon State Universitylocation not on record | 21 |
| New Haven, US | 21 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 19 |
| Porrentruy, CH | 19 |
| San Angelo, US | 18 |
| Spearfish, US | 18 |
| Porvoo, FI | 17 |
| Allentown, US | 17 |
| Stockholm, SE | 17 |
| Vitoria, ES | 17 |
| Glarus, CH | 16 |
| Pocatello, US | 16 |
| Christchurch, NZ | 16 |
| NMBU:MINAlocation not on record | 16 |
| BClocation not on record | 15 |
| Bangkok, TH | 15 |
| Claremont, US | 15 |
| BDBClocation not on record | 15 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| Tula State Universitylocation not on record | 15 |
| Saint John, CA | 14 |
| València, ES | 14 |
| Salamanca, ES | 14 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 14 |
| IWEP FEB RASlocation not on record | 13 |
| Weber State Universitylocation not on record | 13 |
| Frauenfeld, CH | 12 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 12 |
| Auckland, NZ | 12 |
| ASUlocation not on record | 12 |
| Uniwersytet Warszawskilocation not on record | 12 |
| GZUlocation not on record | 12 |
| San Sebastián, ES | 11 |
| Berlin, DE | 10 |
| Yukon Universitylocation not on record | 10 |
| Madrid, ES | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Tromso University Museumlocation not on record | 9 |
| Whitehorse, CA | 9 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 9 |
| Knoxville, US | 8 |
| Missoula, US | 8 |
| Boise, US | 8 |
| Dekalb, US | 8 |
| Tacoma, US | 8 |
| Wuzhou, CN | 8 |
| Northeastern Forestry Universitylocation not on record | 8 |
| Chicago, US | 8 |
| nbflocation not on record | 7 |
| PRClocation not on record | 7 |
| Museo Achille Folettolocation not on record | 7 |
| Nijmegen, NL | 7 |
| Fulda, DE | 6 |
| BSBIlocation not on record | 6 |
| Burlington, US | 6 |
| Riverside, US | 6 |
| Pullman, US | 6 |
| Forssa, FI | 5 |
| Staten Island, US | 5 |
| Rovaniemi, FI | 5 |
| Kew, GB | 5 |
| Phoenix, US | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Zürich, CH | 5 |
| Paris, FR | 5 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 5 |
| Bend, US | 5 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| Tilburg, NL | 5 |
| Finnish Museum of Natural Historylocation not on record | 4 |
| Sion, CH | 4 |
| Karlsruhe, DE | 4 |
| Lausanne, CH | 4 |
| Rocky Mountain Biological Laboratorylocation not on record | 4 |
| Grand Junction, US | 4 |
| Taipei, TW | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| Wellington, NZ | 4 |
| Beijing, CN | 4 |
| Jaén, ES | 3 |
| Namur, BE | 3 |
| Logan, US | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Pittsburg, US | 3 |
| BMlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Sant Julià de Lòria, AD | 3 |
| EL PASO, US | 3 |
| Göteborg, SE | 3 |
| Metsähallituslocation not on record | 3 |
| US | 3 |
| Henderson, US | 3 |
| DULlocation not on record | 3 |
| Trois-Rivières, CA | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| FLADlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| Bourges, FR | 2 |
| AUAlocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Fargo, US | 2 |
| Copenhagen, DK | 2 |
| Columbia, US | 2 |
| Anchorage, US | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Bozeman, US | 2 |
| Saint Louis, US | 2 |
| UGentlocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| North Carolina Museum of Natural Scienceslocation not on record | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| Zürich, CH | 2 |
| Umeå Universitylocation not on record | 2 |
| Dhaka, BD | 2 |
| Honolulu, US | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| University of Birminghamlocation not on record | 2 |
| Xiamen, CN | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| University of Winnipeglocation not on record | 2 |
| Whitewater, US | 2 |
| UnBlocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Dover, US | 2 |
| Lubbock, US | 2 |
| CEPLAClocation not on record | 1 |
| GB | 1 |
| Oswego, US | 1 |
| Santa Barbara, US | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Asheville, US | 1 |
| San Diego, US | 1 |
| Mlocation not on record | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Albuquerque, US | 1 |
| University of New Hampshirelocation not on record | 1 |
| New Brunswick, US | 1 |
| KNFHClocation not on record | 1 |
| Cheney, US | 1 |
| Truckee, US | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Fribourg, CH | 1 |
| Kyoto Universitylocation not on record | 1 |
| INFlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Clemson, US | 1 |
| Moscow, US | 1 |
| GAlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Davis, US | 1 |
| University of Washingtonlocation not on record | 1 |
| Urumqi, CN | 1 |
| Walla Walla, US | 1 |
| BioFokuslocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| University of Western Ontariolocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Chadron, US | 1 |
| ifplocation not on record | 1 |
| Clocation not on record | 1 |
| Granada, ES | 1 |
| Tuscaloosa, US | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Calvin Collegelocation not on record | 1 |
| Davenport, US | 1 |
| Monastir, TN | 1 |
| GINRlocation not on record | 1 |
251 institutions · 18 478 of 19 756 vouchered records shown · 1 088 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA38 detections
Where the DNA of Carex rostrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found38
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 38 detections have coordinates
Open the map7 countries0
in very wet boggy ground
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.6 °C 10.1–16.5
Seasonal swing summer↔winter19.1 °C
Max temp (day)15.6 °C 13.3–20.5
Min temp (night)9.70 °C 7.40–12.0
Precipitation80.9 mm/mo 61.4–121
Air humidity61.3 % 59.0–65.0
Moisture balance-0.2 mm/mo -50.0–54.4
Vapour deficit586 Pa 433–781
Wind speed3.20 m/s 2.00–5.50
Cloud cover50.8 % 38.9–64.6
CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.