Carex rhizina

Blytt ex Lindblom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records1 921

Data sources9

Biological traits16

DNA specimens4

eDNA detections1

Sources9 archives

Databases and archives Carex rhizina's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 921 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF1 921 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT861 Mbp

01Narrative

Carex rhizina is a species of Carex. It is native to temperate Eurasia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.3 m

Plant height max0.5 m

Plant height min0.1 m

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex rhizina has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences3

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN762478.1 ↗620 bpAustria

ACGT

TTGTCGTTGCCTTTCCGAAACACGACCGGTTGAACACGTGACAGAATGCTGCCGCGGAGGCGCCTGCCGCCTCCTCGGCCCCACCGGCCT …

Carex rhizina subsp. rhizina isolate spm00002182 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcLa★ITS1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Carex rhizina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size860 640 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Carex rhizina0.86 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Chromosome records70–702n range70median70mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 702×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Lipnerová I, Bureš P, Horová L, Šmarda P. 2012. Evolution of genome size in Carex (Cyperaceae) in relation to chromosome number and genomic base composition. Annals of Botany.

08Occurrence & distribution

Record type1 921 records

Wild obs. + sensor918

Museum / vouchered995

Other8

Origin

Native6

Range

Area of Occupancy AOO4 736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 313≤1 km 57≤10 km 175>10 km 207

752 georeferenced · 166 without coordinates

Open the mapobservation + sensor918

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 130≤1 km 239≤10 km 249>10 km 39

657 georeferenced · 338 without coordinates

Open the institutions mapphysical evidence995

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	381
Olocation not on record	349
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	68
Tartu, EE	43
Trondheim, NO	41
Bergen, NO	19
BRNUlocation not on record	18
TROMlocation not on record	15
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	9
Philadelphia, US	6
Tallinn, EE	5
Yangling, CN	2
nbflocation not on record	2
PRClocation not on record	2
KMNlocation not on record	2
Prioksko-Terrasnyi Biosphere Reservelocation not on record	1
BioFokuslocation not on record	1
Wlocation not on record	1
Karlsruhe, DE	1
Tromso University Museumlocation not on record	1
Yerevan, AM	1
Tula State Universitylocation not on record	1

22 institutions · 969 of 995 vouchered records shown · 26 without an institution code

09Environmental DNA1 detections

Where the DNA of Carex rhizina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter22.2 °C

Max temp (day)20.2 °C

Min temp (night)13.4 °C

Precipitation104 mm/mo

Air humidity60.8 %

Moisture balance2.00 mm/mo

Vapour deficit763 Pa

Wind speed3.20 m/s

Cloud cover44.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carex rhizina

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 921 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 921 records