Carex recta

Boott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records1 507

Data sources9

Biological traits18

DNA specimens20

eDNA detections11

Sources9 archives

Databases and archives Carex recta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 505 records↗

OBISOcean Biodiversity Information System2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF · OBIS1 507 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB · GoaT2n = 74

01Narrative

Carex recta adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex recta sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Boott.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLEDATRYGIFTWCVP

Size & morphology4

Leaf size3 162 mm²

Plant height0.65 m

Seed length2 mm

Seed mass0.579 mg

Life cycle & reproduction4

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Seed number0

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex recta has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes5

GenBank sequences10

eDNA detections11

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMW398472.1 ↗600 bpDenmark

ACGT

TTGCCTCTCCAGAAACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCTTGCCGCCTCCTCGGCCCCACCGGCCTCCTCCC …

Carex recta isolate REC_DEN_14E9CBB17 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Carex recta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 74 n = 37

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 741×GoaT · DTOL Flowering Plants Estimates Kew

GoaT · DTOL Flowering Plants Estimates Kew

n 731×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Cayouette, J. & P. Morisset. 1985. Chromosome studies on natural hybrids between maritime species of Carex (sections Phacocystis and Cryptocarpae) in northeastern North America, and their taxonomic implications. Canad. J. Bot. 63: 1957–1982.

08Occurrence & distribution

Record type1 507 records

Wild obs. + sensor715

Museum / vouchered790

Cultivated / captive2

Origin

Native94

Range

Area of Occupancy AOO2 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 284≤1 km 330≤10 km 88>10 km 7

709 georeferenced · 6 without coordinates

Open the mapobservation + sensor715

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 50≤1 km 147≤10 km 104>10 km 249

550 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence790

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	220
Bergen, NO	96
Oulu, FI	69
Moscow State Universitylocation not on record	55
Olocation not on record	39
South Kensington, GB	35
Université Lavallocation not on record	31
Kandalaksha State Nature Reservelocation not on record	26
Québec, CA	22
Ann Arbor, US	22
University of Toronto Mississaugalocation not on record	20
Uppsala, SE	20
Toronto, CA	14
Chongqing Museumlocation not on record	14
University of Stellenboschlocation not on record	13
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	10
TUR-Alocation not on record	9
Saint John, CA	9
Montréal, CA	8
Porvoo, FI	7
Acadia Universitylocation not on record	5
University of New Hampshirelocation not on record	3
Madison, US	3
Royal Botanic Garden Edinburghlocation not on record	3
National Museum Waleslocation not on record	2
Bloomington, US	2
Burlington, US	2
Chicago, US	2
University of Birminghamlocation not on record	1
PVTlocation not on record	1
Montréal, CA	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1
WINlocation not on record	1
NMWlocation not on record	1
University of Alberta Museumslocation not on record	1
Kew, GB	1
Tampa, US	1
BSBIlocation not on record	1
KMNlocation not on record	1

39 institutions · 772 of 790 vouchered records shown · 18 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Carex recta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

Willow thickets and swales, in low-lying int…Wet meadow-marsh-pool area behind first low …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 11.6–14.4

Seasonal swing summer↔winter10.9 °C

Max temp (day)15.9 °C 13.0–17.8

Min temp (night)10.4 °C 9.70–11.6

Precipitation66.6 mm/mo 58.6–87.0

Air humidity62.6 % 60.0–66.2

Moisture balance-41.7 mm/mo -51.1–-7.30

Vapour deficit568 Pa 484–628

Wind speed3.90 m/s 2.80–5.60

Cloud cover57.6 % 47.8–59.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carex recta

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 507 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 39 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 507 records