Carex papulosa

Boott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records54

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Carex papulosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF54 records

DNA & barcodingNCBIsequences

01Narrative

Carex papulosa adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex papulosa sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Boott.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex papulosa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC771842.1 ↗597 bpJapan · 2019

ACGT

TTGTCGTTGCCTTTCCAAAAACACGACCGTCGAACACGTGACAGAATGCCGCCGCGGGGGTGCTTGCCGCCTCCTCGGCCCCACCGGCCT …

Carex papulosa T1109 genes for ITS1, 5.8S rRNA, ITS2, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor17

Museum / vouchered37

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 8

8 georeferenced · 9 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤1 km 1≤10 km 9

10 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nagano City, JP	10
SIHUlocation not on record	9
Plocation not on record	5
Kyoto Universitylocation not on record	3
Tsukuba, JP	2
KR	2
Tomioka, JP	2
Moscow State Universitylocation not on record	1
Nishihara, JP	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
Taipei, TW	1

11 institutions · 37 of 37 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)