Carex nigra
(L.) Reichard · speciesAt a glance
Occurrence records394 890
Data sources12
Biological traits51
DNA specimens85
eDNA detections46
Sources12 archives
Databases and archives Carex nigra's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility394 890 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics85 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources51 traits
Chemical compositionLOTUS · NPASS13 compounds
Occurrence & distributionGBIF394 890 records
Environmental DNA1 datasets · 9 countries46 detections
DNA & barcodingBOLD · NCBI85 specimens
Genome at a glanceCCDB · GoaT · NCBI479 Mbp
01Narrative
Carex nigra, la Laîche noire, est une espèce de plantes à fleurs, de la famille des Cypéracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Leaf mass8.57 mg
Leaf size728 mm²
⚠ sources differ — TRY: 728 mm² · LEDA: 154 mm² · GIFT: 159 mm²
Plant height0.11 m
⚠ sources differ — GIFT: 0.11 m · LEDA: 0.11 m · TRY: 0.283 m
Plant height generative0.136 m
Plant height max0.8 m
Plant height min0.05 m
Seed length2.7 mm
Seed mass0.736 mg
Seed mass max0.89 mg
Seed mass min0.65 mg
Seed volume0.64 mm³
Seed volume max0.64 mm³
Seed volume min0.64 mm³
Life cycle & reproduction14
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typewater
Flowering endAug
Flowering startApr
Life formperennial or rhizomatous geophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formcryptophyte
⚠ sources differ — LEDA: Geophyte · GIFT: hemicryptophyte
Reproduction asexualabsent
Seed number59 329
Self fertilizationabsent
Sex typemonoecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 900 m
Elevation min2 400 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTmeadows, swamps
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio23.16 g/g
Leaf c463 mg/g
Leaf dry-matter content (LDMC)344 mg/g
⚠ sources differ — TRY: 344 mg/g · LEDA: 387 mg/g
Leaf n21.06 mg/g
Leaf p2.05 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)21.43 mm²/mg
⚠ sources differ — TRY: 21.43 mm²/mg · LEDA: 18.02 mm²/mg · GIFT: 17.79 mm²/mg
Other traits2
Diaspore typegenerative dispersule
Seeds per fruit101-1000
03Chemical composition13 compounds
Compounds documented for Carex nigra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Flavonols1
Flavones1
Cembrane diterpenoids1
Cholestane steroids $ Ergostane steroids1
Documented compounds13 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1E,3E,7R*,8R*,11E)-1-(2-Methoxypropan-2-Yl)-4,8,12-Trimethyloxabicyclo[12.1.0]-Pentadeca-1,3,11-Triene | present | NPASS | |
| (1R,2E,6R,8S,11E)-3,8,12,16-tetramethyl-7,18-dioxatricyclo[13.3.0.06,8]octadeca-2,11,15-triene | present | NPASS | |
| (1S,2R,5R,6R,9R,10R,13S,15S)-5-[(2R,5S)-5,6-dimethylheptan-2-yl]-6,10-dimethyl-16,17-dioxapentacyclo[13.2.2.01,9.02,6.010,15]nonadec-18-en-13-ol | present | NPASS | |
| FYNMKNFAKCHMLL-PPXWZDJSSA-N | present | NPASS | |
| IRLJYXHINXXWKC-GHZBUWTKSA-N | present | NPASS | |
| Isorhamnetin | present | LOTUS | |
| KBQKZBYGDQCBTJ-NPVOAUDJSA-N | present | NPASS | |
| OAWYUCSBLMUTFD-IHYVIKNBSA-N | present | NPASS | |
| OKPPSLJDJGOWAJ-MVZXQZHKSA-N | present | NPASS | |
| OQGXDKRHMBRZCS-SLFFLAALSA-N | present | NPASS |
05DNA & barcoding85 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex nigra has left across the world's sequence archives.
At a glance
DNA specimens85
Marker genes6
GenBank sequences10
eDNA detections46
Countries12
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Carex nigra voucher EDNA21-0061101 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Carex nigra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size479 220 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex nigra0.48 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 84 n = 42
Chromosome records74–922n range84median84mode37records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 8426×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · fl-europaea — Knaben Engelskjon
CCDB · mediterranean
CCDB · cyper-only — 132Tischler, G.1934
CCDB · cyper-only — 132Rohweder, H.1937
CCDB · cyper-only — Lve, . & D. Lve1956
CCDB · cyper-only — 132Tischler, G.1950
CCDB · cyper-only — Stoeva, M. P.1994
CCDB · cyper-only — Druskovic, L. P.1995
CCDB · cyper-only — 133Heilborn, O.1922
CCDB · cyper-only — 136Knaben, G. & T. Engelskjon1967
CCDB · cyper-only — 136Faulkner, J. S.1972
CCDB · ipcn-api-dl — Stoeva, M. 1994. Mediterranean chromosome number reports 4 (285--293). Fl. Medit. 4: 258–262.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Rotreklová, O. & Bureš, P. & ?epka, R. & Grulich, V. & Šmarda, P. & Hralová, I. & Zedek, F.& Koutecký, T. (2011). Chromosome numbers of Carex Preslia 83: 25–58
CCDB · CromoCat 2015 — Cayouette, J. & Morisset, P. (1986). Chromosome studies on Carex paleacea Wahl., C. nigra (L.) Reichard and C. aquatilis Wahl. in northeastern North America. Cytologia 52: 857-883.
CCDB · CromoCat 2015 — Faulkner, J. (1972). Chromosome studies on Carex section Acutae in north-west Europe. Bot. J. Linn. Soc. 65: 271-301.
CCDB · CromoCat 2015 — Luceño, M. & Aedo, C. (1994). Taxonomic revision of the Iberian species of Carex L. section Phacocystis Dumort. Bot. J. Linn. Soc. 114: 183-214.
CCDB · CromoCat 2015 — Standley, L. (1987). Anatomical and chromosomal studies of Carex sect. Phacocystis in eastern North America. Bot. Gaz. 148: 507-518.
CCDB · CromoCat 2015 — Stoeva, M. P. (1994). Reports (285-293). Fl. Medit. 4: 258-262.
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
CCDB · iapt — IAPT/IOPB Chromosome Data 28
2n 856×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · CromoCat 2015 · CCDB · iapt
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · CromoCat 2015 — Cayouette, J. & Morisset, P. (1986). Chromosome studies on Carex paleacea Wahl., C. nigra (L.) Reichard and C. aquatilis Wahl. in northeastern North America. Cytologia 52: 857-883.
CCDB · CromoCat 2015 — Faulkner, J. (1972). Chromosome studies on Carex section Acutae in north-west Europe. Bot. J. Linn. Soc. 65: 271-301.
CCDB · CromoCat 2015 — Luceño, M. & Aedo, C. (1994). Taxonomic revision of the Iberian species of Carex L. section Phacocystis Dumort. Bot. J. Linn. Soc. 114: 183-214.
CCDB · CromoCat 2015 — Standley, L. (1987). Anatomical and chromosomal studies of Carex sect. Phacocystis in eastern North America. Bot. Gaz. 148: 507-518.
CCDB · iapt — IAPT/IOPB Chromosome Data 28
2n 804×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · cyper-only — 136Dmitrieva, S. A.1985
CCDB · cyper-only — Cayouette, J. & P. Morisset1985
CCDB · ipcn-api-dl — Cayouette, J. & P. Morisset. 1985. Chromosome studies on natural hybrids between maritime species of Carex (sections Phacocystis and Cryptocarpae) in northeastern North America, and their taxonomic implications. Canad. J. Bot. 63: 1957–1982.
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1985a). Chromosome numbers in some representatives of the families Apiaceae, Brassicaceae, Caryophyllaceae and Cyperaceae in the Bielorussian flora. Bot. Žurn. 70: 994-995.
2n 834×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · CromoCat 2015 · CCDB · iapt
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · CromoCat 2015 — Cayouette, J. & Morisset, P. (1986). Chromosome studies on Carex paleacea Wahl., C. nigra (L.) Reichard and C. aquatilis Wahl. in northeastern North America. Cytologia 52: 857-883.
CCDB · CromoCat 2015 — Pogan, E., R. Czapik, A. Jankun & E. Kuta. (1982b). Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 91-126.
CCDB · iapt — IAPT/IOPB Chromosome Data 28
2n 732×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Cayouette, J. & P. Morisset. 1985. Chromosome studies on natural hybrids between maritime species of Carex (sections Phacocystis and Cryptocarpae) in northeastern North America, and their taxonomic implications. Canad. J. Bot. 63: 1957–1982.
CCDB · CromoCat 2015 — Cayouette, J. & Morisset, P. (1985). Chromosome studies on natural hybrids between maritime species of Carex (sections Phacocystis and Cryptocarpae) in northeastern North America, and their taxonomic implications. Canadian Journal of Botany 63: 1957-1982
2n 762×CCDB · fl-europaea · CCDB · cyper-only
CCDB · fl-europaea — LOve & LOve, 1956
CCDB · cyper-only — 136Lve, . & D. Lve1956
2n 882×CCDB · cyper-only · CCDB · book-ipcn67-71
CCDB · cyper-only — 134Hess, H. E., E. Landolt & R. Hirzel1967
CCDB · book-ipcn67-71 — HESS, H.E.' E. LANDOLT, & R. HIRZEL. 1967. Flora der Schweiz und angrenzender Gebiete. Band I: Pteridophyte bis Caryophyllaceae. Birkhausen Verlag, Basel & Stuttgart. 858 pp.
2n 741×CCDB · cyper-only
CCDB · cyper-only — 136Lve, . & D. Lve1944
2n 791×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Cayouette, J. & Morisset, P. (1985). Chromosome studies on natural hybrids between maritime species of Carex (sections Phacocystis and Cryptocarpae) in northeastern North America, and their taxonomic implications. Canadian Journal of Botany 63: 1957-1982
2n 811×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Cayouette, J. & Morisset, P. (1985). Chromosome studies on natural hybrids between maritime species of Carex (sections Phacocystis and Cryptocarpae) in northeastern North America, and their taxonomic implications. Canadian Journal of Botany 63: 1957-1982
2n 861×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 28
2n 921×CCDB · cyper-only
CCDB · cyper-only — 136Hess, H. E., E. Landolt & R. Hirzel1967
n 428×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +2
CCDB · cyper-only — Davies, E. W.1956a
CCDB · cyper-only — Davies, E. W.1956b
CCDB · cyper-only — Dietrich, W.1972
CCDB · cyper-only — Manhart, J. R.1987
CCDB · ipcn-api-dl — Luceño, M. & C. Aedo. 1994. Taxonomic revision of the Iberian species of Carex L. section Phacocystis Dumort. (Cyperaceae). Bot. J. Linn. Soc. 114: 183–214.
CCDB · book-ipcn72 — DIETRICH, w. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · Cave1956 — Davies a, b
CCDB · CromoCat 2015 — Dietrich, W. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVI]. Taxon 21(2/3): 333-335.
n 435×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · cyper-only — 134Favarger, C., N. Galland & P. H. Kupper1979
CCDB · cyper-only — 135Galland, N.1988
CCDB · ipcn-api-dl — Favarger, C., N. Galland & P. Kupper. 1979. Recherches cytotaxonomiques sur la flore orophile du Maroc. Nat. Monspel., Sér. Bot. 29: 1–64.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · CromoCat 2015 — Cayouette, J. & Morisset, P. (1986). Chromosome studies on Carex paleacea Wahl., C. nigra (L.) Reichard and C. aquatilis Wahl. in northeastern North America. Cytologia 52: 857-883.
n 441×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Cayouette, J. & Morisset, P. (1986). Chromosome studies on Carex paleacea Wahl., C. nigra (L.) Reichard and C. aquatilis Wahl. in northeastern North America. Cytologia 52: 857-883.
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness75% BUSCO
08Occurrence & distribution
Record type394 890 records
Wild obs. + sensor371 179
Museum / vouchered20 892
Cultivated / captive31
Fossil3
Other2 785
Origin
Native28 491
Range
Area of Occupancy AOO391 524 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy48% within 1 km
≤100 m 77 416≤1 km 63 651≤10 km 151 792>10 km 1 651
294 510 georeferenced · 76 669 without coordinates
Open the mapobservation + sensor371 179
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 1 411≤1 km 5 012≤10 km 7 130>10 km 1 614
15 167 georeferenced · 5 725 without coordinates
Open the institutions mapphysical evidence20 892
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 17
18 georeferenced · 13 without coordinates
Open the mapnot free-living31
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions92 of 190 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 7 371 |
| Helsinki, FI | 1 189 |
| South Kensington, GB | 1 105 |
| LDlocation not on record | 946 |
| Moscow State Universitylocation not on record | 745 |
| Olocation not on record | 460 |
| BRNUlocation not on record | 451 |
| Garðabær, IS | 412 |
| Salzburg, AT | 398 |
| Tartu, EE | 329 |
| Oulu, FI | 313 |
| Turku, FI | 291 |
| MeiseBGlocation not on record | 240 |
| Kuopio, FI | 240 |
| BFLlocation not on record | 236 |
| Trondheim, NO | 210 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 203 |
| Oskarshamn, SE | 193 |
| 175 | |
| Provincia di Livornolocation not on record | 165 |
| Uniwersytet Śląski w Katowicachlocation not on record | 151 |
| KMNlocation not on record | 144 |
| TROMlocation not on record | 126 |
| DBF-NHMDlocation not on record | 126 |
| Jyväskylä, FI | 122 |
| CJBGlocation not on record | 120 |
| Entomological Society of Latvialocation not on record | 119 |
| SLU Artdatabankenlocation not on record | 114 |
| MAlocation not on record | 110 |
| Acadia Universitylocation not on record | 106 |
| Bergen, NO | 104 |
| Uppsala, SE | 102 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 101 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 97 |
| Philadelphia, US | 86 |
| Kandalaksha State Nature Reservelocation not on record | 79 |
| Montréal, CA | 78 |
| Barcelona, ES | 76 |
| Québec, CA | 65 |
| Wlocation not on record | 61 |
| Université Lavallocation not on record | 59 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 57 |
| Bern, CH | 56 |
| GJOlocation not on record | 56 |
| BDBClocation not on record | 55 |
| GZUlocation not on record | 47 |
| Chicago, US | 45 |
| LfUlocation not on record | 39 |
| University of New Hampshirelocation not on record | 38 |
| Mlocation not on record | 38 |
| Uniwersytet Warszawskilocation not on record | 38 |
| València, ES | 36 |
| Tallinn, EE | 33 |
| Dresden, DE | 32 |
| Vitoria, ES | 31 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 30 |
| Salamanca, ES | 29 |
| BClocation not on record | 26 |
| SZUlocation not on record | 26 |
| TUR-Alocation not on record | 26 |
| Madison, US | 23 |
| Auckland, NZ | 23 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 22 |
| Karlsruhe, DE | 22 |
| CICYTEXlocation not on record | 22 |
| Görlitz, DE | 18 |
| Ann Arbor, US | 18 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 18 |
| Saint John, CA | 18 |
| Burlington, US | 17 |
| Tilburg, NL | 16 |
| PrivatHerblocation not on record | 16 |
| Tampa, US | 16 |
| Porrentruy, CH | 15 |
| Berlin, DE | 14 |
| Chongqing Museumlocation not on record | 14 |
| Madrid, ES | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| PRClocation not on record | 13 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| Irkutsk State Universitylocation not on record | 11 |
| Tula State Universitylocation not on record | 10 |
| Glarus, CH | 10 |
| BSBIlocation not on record | 9 |
| nbflocation not on record | 9 |
| Granada, ES | 8 |
| Frauenfeld, CH | 8 |
| Tromso University Museumlocation not on record | 8 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 8 |
| John May Museum of Natural Historylocation not on record | 8 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 8 |
| BIO-UNIPIlocation not on record | 7 |
| University of Toronto Mississaugalocation not on record | 7 |
| Christchurch, NZ | 7 |
| San Sebastián, ES | 6 |
| Forssa, FI | 6 |
| Paris, FR | 6 |
| Rovaniemi, FI | 6 |
| SNSNMClocation not on record | 6 |
| University of Alberta Museumslocation not on record | 5 |
| NBSIlocation not on record | 5 |
| Nijmegen, NL | 5 |
| Vancouver, CA | 5 |
| AASlocation not on record | 5 |
| Bronx, US | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Göteborg, SE | 5 |
| New Haven, US | 5 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Durham, US | 4 |
| Montréal, CA | 4 |
| Namur, BE | 4 |
| Metsähallituslocation not on record | 4 |
| Zürich, CH | 4 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Bloomington, US | 3 |
| Podgorica, ME | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| München, DE | 3 |
| Xiamen, CN | 3 |
| Wellington, NZ | 3 |
| Stockholm, SE | 3 |
| Jaén, ES | 3 |
| Zürich, CH | 3 |
| Toronto, CA | 3 |
| Lausanne, CH | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| Kew, GB | 2 |
| University of Winnipeglocation not on record | 2 |
| H-AkrKGlocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| University of Hulllocation not on record | 2 |
| Alicante, ES | 2 |
| University of Birminghamlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Green Bay, US | 2 |
| University of Stellenboschlocation not on record | 2 |
| Saint Louis, US | 2 |
| Bangkok, TH | 2 |
| Flagstaff, US | 2 |
| Brussel, BE | 2 |
| Badajoz, ES | 2 |
| WTUlocation not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Whitehorse, CA | 2 |
| UGentlocation not on record | 2 |
| Copenhagen, DK | 2 |
| Ivano-Frankove, UA | 2 |
| Meguro Parasitological Museumlocation not on record | 1 |
| UnBlocation not on record | 1 |
| EL PASO, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Pamplona, ES | 1 |
| Taipei, TW | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Bourges, FR | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Victoria, CA | 1 |
| Clocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| H-Adlerlocation not on record | 1 |
| WINlocation not on record | 1 |
| St. Paul, US | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Dover, US | 1 |
| Denver, US | 1 |
| Yerevan, AM | 1 |
| Sion, CH | 1 |
| Porvoo, FI | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Moscow, US | 1 |
| ISAlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| BMlocation not on record | 1 |
| NMWlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 1 |
| Delaware State University, Claude E. Phillips Herbariumlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Chicago, US | 1 |
| Corvallis, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Logan, US | 1 |
190 institutions · 19 253 of 20 892 vouchered records shown · 1 487 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA46 detections
Where the DNA of Carex nigra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found46
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 46 detections have coordinates
Open the map9 countries0
Baissiere humide en arriere de la greve.Sur les rochers denudes.tussock in in standing waterAnfractuosite de rochers de la greve et de l…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.1 °C 10.1–16.2
Seasonal swing summer↔winter15.3 °C
Max temp (day)15.6 °C 11.8–20.5
Min temp (night)10.0 °C 7.00–11.9
Precipitation77.3 mm/mo 59.8–111
Air humidity62.6 % 58.7–65.5
Moisture balance-10.3 mm/mo -51.8–30.9
Vapour deficit573 Pa 455–777
Wind speed4.40 m/s 2.30–5.90
Cloud cover50.0 % 35.6–64.0
CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.