Carex neurophora — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records247

Data sources8

Biological traits10

DNA specimens13

eDNA detections9

Sources8 archives

Databases and archives Carex neurophora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility247 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF247 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI13 specimens

01Narrative

Carex neurophora is a species of sedge known by the common name alpine nerve sedge. It is native to the western United States, where it grows in wet mountain habitat such as meadows and streambanks. This sedge produces stems up to about 60 centimeters tall and inflorescences which are dense, oblong clusters of indistinguishable spikes of flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex neurophora has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes6

GenBank sequences9

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK581502.1 ↗604 bpUSA

ACGT

TCGTTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGGACGCTGTCGGAGAGGTGCTTGCTGCCTCCTCGGCCCCACCGGCCTCGT …

Carex neurophora isolate B1008 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL3rbcLatrnL-FITS5ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type247 records

Wild obs. + sensor15

Museum / vouchered232

Range

Area of Occupancy AOO776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 10≤1 km 3>10 km 1

14 georeferenced · 1 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 8≤1 km 61≤10 km 44>10 km 2

115 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence232

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	32
WTUlocation not on record	30
Pullman, US	24
Missoula, US	17
Moscow, US	15
Bronx, US	13
Musee des Dinosaures d'Esperaza (Aude)location not on record	7
Bozeman, US	7
Claremont, US	7
Provo, US	6
Boise, US	6
Museum of the Rockieslocation not on record	5
Arcata, US	5
Denver, US	5
San Angelo, US	4
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	4
DOI/NPS, Colonial National Historical Parklocation not on record	4
Flagstaff, US	4
Madison, US	3
Pocatello, US	3
Yellowstone National Park Herbariumlocation not on record	3
Jackson, US	3
Ann Arbor, US	2
Chicago, US	2
Logan, US	2
Riverside, US	2
Tacoma, US	1
Davis, US	1
US	1
Weber State Universitylocation not on record	1
Knoxville, US	1
EL PASO, US	1
Pittsburg, US	1
Bend, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Caldwell, US	1
Ashland, US	1

37 institutions · 226 of 232 vouchered records shown · 6 without an institution code

09Environmental DNA9 detections

Where the DNA of Carex neurophora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

Wetland by edge of trailWet stream just west of cabin in dry meadowUnder Spruce/fir forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 12.9–14.6

Seasonal swing summer↔winter24.5 °C

Max temp (day)21.8 °C 20.5–21.8

Min temp (night)7.80 °C 5.50–7.80

Precipitation61.5 mm/mo 61.5–64.9

Air humidity46.2 % 45.2–46.2

Moisture balance-77.6 mm/mo -77.6–-76.5

Vapour deficit895 Pa 819–895

Wind speed2.10 m/s 2.10–3.30

Cloud cover24.3 % 24.3–26.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.