Carex nervina

L.H.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records172

Data sources8

Biological traits10

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Carex nervina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility172 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF172 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 52

01Narrative

Carex nervina is a species of sedge known by the common name Sierra sedge.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex nervina has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences4

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN762732.1 ↗604 bpUSA

ACGT

TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGAACGCTGTCGGAGAGGTGCTTGCTGCCTCCTCGGCCCCACCGGCCTCGTCCC …

Carex nervina isolate spm00002532 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex nervina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 521×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 28

08Occurrence & distribution

Record type172 records

Wild obs. + sensor6

Museum / vouchered166

Origin

Native3

Range

Area of Occupancy AOO468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 5≤1 km 42≤10 km 15

62 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	37
Arcata, US	10
Claremont, US	10
Davis, US	9
Flagstaff, US	9
CASlocation not on record	6
WTUlocation not on record	4
Canadian Department of Agriculturelocation not on record	4
Jackson, US	4
Riverside, US	4
Henderson, US	3
Santa Barbara, US	3
Chicago, US	3
Bronx, US	3
Jepson Herbarium, Berkeleylocation not on record	2
Wuzhou, CN	2
Taipei, TW	2
GAlocation not on record	2
Angwin, US	2
Moscow, US	2
University of Stellenboschlocation not on record	2
Ann Arbor, US	2
Caldwell, US	1
Logan, US	1
STNFlocation not on record	1
Phoenix, US	1
Fredericton Stock Culture Collectionlocation not on record	1
Mexico City, MX	1
Ashland, US	1
Boise, US	1
Saint Louis, US	1
Museum of the Rockieslocation not on record	1
Chongqing Museumlocation not on record	1
Corvallis, US	1
KNFYlocation not on record	1
San Diego, US	1
EL PASO, US	1

37 institutions · 140 of 166 vouchered records shown · 26 without an institution code

09Environmental DNA6 detections

Where the DNA of Carex nervina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 17.5–17.5

Seasonal swing summer↔winter19.7 °C

Max temp (day)24.2 °C

Min temp (night)9.90 °C

Precipitation36.8 mm/mo

Air humidity45.1 %

Moisture balance-125 mm/mo

Vapour deficit1,104 Pa

Wind speed2.20 m/s

Cloud cover41.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)